Transcript: Human NM_001317939.2

Homo sapiens basonuclin 2 (BNC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
BNC2 (54796)
Length:
12738
CDS:
23..2608

Additional Resources:

NCBI RefSeq record:
NM_001317939.2
NBCI Gene record:
BNC2 (54796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336904 CCATAGTCAGTGTGCGCTTAT pLKO_005 3311 3UTR 100% 10.800 15.120 N BNC2 n/a
2 TRCN0000108178 CGTAAACTGTTGACCAAAGAA pLKO.1 2617 3UTR 100% 5.625 7.875 N BNC2 n/a
3 TRCN0000327841 CGTAAACTGTTGACCAAAGAA pLKO_005 2617 3UTR 100% 5.625 7.875 N BNC2 n/a
4 TRCN0000108175 GCCGAATGTTATTAGAATCAA pLKO.1 4363 3UTR 100% 5.625 7.875 N BNC2 n/a
5 TRCN0000336902 CTCCCTAGCCAGCTAGTATTT pLKO_005 1556 CDS 100% 13.200 10.560 N BNC2 n/a
6 TRCN0000108177 CCCTGTCATAGCAAGTACAAA pLKO.1 1453 CDS 100% 5.625 4.500 N BNC2 n/a
7 TRCN0000108176 CGCTGATACTAACCTCTTATT pLKO.1 190 CDS 100% 13.200 9.240 N BNC2 n/a
8 TRCN0000108179 CCCAGCCTTTCAACTCAGAAT pLKO.1 959 CDS 100% 4.950 3.465 N BNC2 n/a
9 TRCN0000327840 CCCAGCCTTTCAACTCAGAAT pLKO_005 959 CDS 100% 4.950 3.465 N BNC2 n/a
10 TRCN0000095489 GCATGGCAGATTCACCTGTAA pLKO.1 3758 3UTR 100% 4.950 3.465 N Bnc2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3551 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.