Transcript: Human NM_001317965.1

Homo sapiens leucyl-tRNA synthetase 1 (LARS1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-17
Taxon:
Homo sapiens (human)
Gene:
LARS1 (51520)
Length:
4805
CDS:
338..3706

Additional Resources:

NCBI RefSeq record:
NM_001317965.1
NBCI Gene record:
LARS1 (51520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045325 CCAGGGCTTTACCAAAGACAA pLKO.1 1183 CDS 100% 4.950 6.930 N LARS1 n/a
2 TRCN0000290511 CCAGGGCTTTACCAAAGACAA pLKO_005 1183 CDS 100% 4.950 6.930 N LARS1 n/a
3 TRCN0000045324 GCTGTGCTTATGGAGAATATA pLKO.1 3227 CDS 100% 15.000 10.500 N LARS1 n/a
4 TRCN0000290512 GCTGTGCTTATGGAGAATATA pLKO_005 3227 CDS 100% 15.000 10.500 N LARS1 n/a
5 TRCN0000045326 CGCTCCATTCTGTCCACATTT pLKO.1 2752 CDS 100% 13.200 9.240 N LARS1 n/a
6 TRCN0000045323 GCTAACTATTAAGGAGGATAA pLKO.1 1306 CDS 100% 10.800 7.560 N LARS1 n/a
7 TRCN0000290442 GCTAACTATTAAGGAGGATAA pLKO_005 1306 CDS 100% 10.800 7.560 N LARS1 n/a
8 TRCN0000045327 CCTCACTTTGACCCAAGCTAT pLKO.1 2347 CDS 100% 4.950 3.465 N LARS1 n/a
9 TRCN0000290440 CCTCACTTTGACCCAAGCTAT pLKO_005 2347 CDS 100% 4.950 3.465 N LARS1 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4535 3UTR 100% 13.200 6.600 Y IQCC n/a
11 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 4634 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03323 pDONR223 100% 95.4% 95.4% None 0_1ins162 n/a
2 ccsbBroad304_03323 pLX_304 0% 95.4% 95.4% V5 0_1ins162 n/a
Download CSV