Transcript: Human NM_001318066.2

Homo sapiens SEC24 homolog D, COPII coat complex component (SEC24D), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SEC24D (9871)
Length:
4021
CDS:
228..3329

Additional Resources:

NCBI RefSeq record:
NM_001318066.2
NBCI Gene record:
SEC24D (9871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244237 ATCCGGGAAATTCTAGTTAAT pLKO_005 2643 CDS 100% 13.200 18.480 N SEC24D n/a
2 TRCN0000244450 GAGTTATCTCTAGGATCTTAT pLKO_005 1476 CDS 100% 13.200 10.560 N SEC24D n/a
3 TRCN0000065170 CGGATTCACAATCTTGGCTTA pLKO.1 2511 CDS 100% 4.050 3.240 N SEC24D n/a
4 TRCN0000065172 GCATGATACAAGACCAAGGAA pLKO.1 1126 CDS 100% 3.000 2.400 N SEC24D n/a
5 TRCN0000244452 AGGCCTACATGTGCCCATTTA pLKO_005 1330 CDS 100% 13.200 9.240 N SEC24D n/a
6 TRCN0000244236 ATCCCAATCTGTGATTCATAA pLKO_005 1823 CDS 100% 13.200 9.240 N SEC24D n/a
7 TRCN0000065171 GCACTTGGATAGACAACAATT pLKO.1 2228 CDS 100% 13.200 9.240 N SEC24D n/a
8 TRCN0000244451 TCAGGTATAAAGCCAATTAAG pLKO_005 3486 3UTR 100% 13.200 9.240 N SEC24D n/a
9 TRCN0000065169 CCACCATTCTATTTCCAACAT pLKO.1 1413 CDS 100% 4.950 3.465 N SEC24D n/a
10 TRCN0000065168 CCCGTCTTTCAGAAGAAGGAA pLKO.1 2962 CDS 100% 3.000 2.100 N SEC24D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318066.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11426 pDONR223 100% 99.9% 100% None 2397C>T n/a
2 ccsbBroad304_11426 pLX_304 0% 99.9% 100% V5 2397C>T n/a
Download CSV