Transcript: Human NM_001318246.1

Homo sapiens cAMP responsive element binding protein 3 like 2 (CREB3L2), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
CREB3L2 (64764)
Length:
7054
CDS:
173..1546

Additional Resources:

NCBI RefSeq record:
NM_001318246.1
NBCI Gene record:
CREB3L2 (64764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016438 CGGAAGAAGGTAGAGGTTCTA pLKO.1 992 CDS 100% 4.950 6.930 N CREB3L2 n/a
2 TRCN0000274872 TCCTCGTGCCAGACCATTATT pLKO_005 485 CDS 100% 15.000 10.500 N CREB3L2 n/a
3 TRCN0000274803 CATAATGCCTGTTGGTATTTG pLKO_005 1949 3UTR 100% 13.200 9.240 N CREB3L2 n/a
4 TRCN0000274870 TCCTCACGGCTCCTCATAAAC pLKO_005 735 CDS 100% 13.200 9.240 N CREB3L2 n/a
5 TRCN0000274801 TTCGGAGGAAGATCAAGAATA pLKO_005 876 CDS 100% 13.200 9.240 N CREB3L2 n/a
6 TRCN0000084448 GCAGGCTTGTTTCCACCAATA pLKO.1 1820 3UTR 100% 10.800 7.560 N Creb3l2 n/a
7 TRCN0000331759 GCAGGCTTGTTTCCACCAATA pLKO_005 1820 3UTR 100% 10.800 7.560 N Creb3l2 n/a
8 TRCN0000016439 CTGCTGATCTACGAGGAACAT pLKO.1 1268 CDS 100% 4.950 3.465 N CREB3L2 n/a
9 TRCN0000274869 CTGCTGATCTACGAGGAACAT pLKO_005 1268 CDS 100% 4.950 3.465 N CREB3L2 n/a
10 TRCN0000016442 GCCTGGAGAAGTCAGTGCTTT pLKO.1 1431 CDS 100% 4.950 3.465 N CREB3L2 n/a
11 TRCN0000084450 GTCTTGTTCAACTGAGAACTT pLKO.1 964 CDS 100% 4.950 3.465 N Creb3l2 n/a
12 TRCN0000301786 GTCTTGTTCAACTGAGAACTT pLKO_005 964 CDS 100% 4.950 3.465 N Creb3l2 n/a
13 TRCN0000016441 TCAGAACTTCTGGATGAGTTT pLKO.1 92 5UTR 100% 4.950 3.465 N CREB3L2 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5654 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318246.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12485 pDONR223 100% 32% 25.8% None (many diffs) n/a
2 ccsbBroad304_12485 pLX_304 0% 32% 25.8% V5 (many diffs) n/a
Download CSV