Transcript: Human NM_001318532.2

Homo sapiens trafficking protein particle complex 2 like (TRAPPC2L), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
TRAPPC2L (51693)
Length:
2479
CDS:
434..760

Additional Resources:

NCBI RefSeq record:
NM_001318532.2
NBCI Gene record:
TRAPPC2L (51693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059885 CAACGAAATTCGCAGCATGTT pLKO.1 619 CDS 100% 4.950 6.930 N TRAPPC2L n/a
2 TRCN0000059884 GCCCTTCGAGACAACGAAATT pLKO.1 608 CDS 100% 13.200 10.560 N TRAPPC2L n/a
3 TRCN0000286499 GCCCTTCGAGACAACGAAATT pLKO_005 608 CDS 100% 13.200 10.560 N TRAPPC2L n/a
4 TRCN0000059886 CGATGATGATACAGGTGTGCT pLKO.1 738 CDS 100% 2.640 2.112 N TRAPPC2L n/a
5 TRCN0000298640 GTTTGTCATGGTGGTAGATTC pLKO_005 577 CDS 100% 10.800 7.560 N TRAPPC2L n/a
6 TRCN0000293992 ACTCCTACACAGACGTGATGT pLKO_005 654 CDS 100% 4.950 3.465 N TRAPPC2L n/a
7 TRCN0000059883 CGAGCTGAAGTTCCACTACAT pLKO.1 96 5UTR 100% 4.950 3.465 N TRAPPC2L n/a
8 TRCN0000286498 CGAGCTGAAGTTCCACTACAT pLKO_005 96 5UTR 100% 4.950 3.465 N TRAPPC2L n/a
9 TRCN0000059887 CGGCTACGTCACCAACTCCAA pLKO.1 550 CDS 100% 0.880 0.616 N TRAPPC2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318532.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12006 pDONR223 100% 68.5% 48.3% None (many diffs) n/a
2 ccsbBroad304_12006 pLX_304 0% 68.5% 48.3% V5 (many diffs) n/a
3 TRCN0000474517 TTCGGCCATTGGACGTGCAAAACG pLX_317 97.4% 68.5% 48.3% V5 (many diffs) n/a
Download CSV