Transcript: Human NM_001318718.1

Homo sapiens kelch repeat and BTB domain containing 4 (KBTBD4), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
KBTBD4 (55709)
Length:
2470
CDS:
87..1718

Additional Resources:

NCBI RefSeq record:
NM_001318718.1
NBCI Gene record:
KBTBD4 (55709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413639 TGTCTTCCGGGACCGATATAA pLKO_005 1592 CDS 100% 15.000 21.000 N KBTBD4 n/a
2 TRCN0000431951 GCATGTGGAAGTGCAACAATG pLKO_005 1051 CDS 100% 10.800 15.120 N KBTBD4 n/a
3 TRCN0000144516 CTTTCAAAGATCGGTCACATT pLKO.1 220 CDS 100% 4.950 6.930 N KBTBD4 n/a
4 TRCN0000139228 CCGATCCATGTTCACTTCCAA pLKO.1 371 CDS 100% 3.000 4.200 N KBTBD4 n/a
5 TRCN0000416631 GACTAAGCTGAAGGTGTACTT pLKO_005 2181 3UTR 100% 4.950 3.960 N KBTBD4 n/a
6 TRCN0000144852 GAAGCCTGGATCAACTTTAAT pLKO.1 789 CDS 100% 15.000 10.500 N KBTBD4 n/a
7 TRCN0000433383 CCACAAAGAATTAGGTGTTAA pLKO_005 2128 3UTR 100% 13.200 9.240 N KBTBD4 n/a
8 TRCN0000145110 GCTCCTGGTTGATTATATCTA pLKO.1 452 CDS 100% 5.625 3.938 N KBTBD4 n/a
9 TRCN0000141375 GAGGTATTAAGGTGCTGCTTA pLKO.1 1672 CDS 100% 4.950 3.465 N KBTBD4 n/a
10 TRCN0000142565 GCTGCTTACCAATTTGCAGTT pLKO.1 1685 CDS 100% 4.050 2.835 N KBTBD4 n/a
11 TRCN0000141254 CGCAGTCATTTATTATCGCGT pLKO.1 1199 CDS 100% 0.660 0.462 N KBTBD4 n/a
12 TRCN0000140781 GCTTGCTTAGAGCAAGCCTTT pLKO.1 1970 3UTR 100% 0.405 0.284 N KBTBD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318718.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03635 pDONR223 100% 95.3% 95.3% None 1_75del n/a
2 ccsbBroad304_03635 pLX_304 0% 95.3% 95.3% V5 1_75del n/a
3 TRCN0000471095 GTCGCTACTGCAAACCAGACACGG pLX_317 30.4% 95.3% 95.3% V5 1_75del n/a
Download CSV