Construct: ORF TRCN0000471095
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001309.1_s317c1
- Derived from:
- ccsbBroadEn_03635
- DNA Barcode:
- GTCGCTACTGCAAACCAGACACGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KBTBD4 (55709)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000471095
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318721.1 | 100% | 100% | |
2 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318722.1 | 100% | 100% | |
3 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318723.1 | 100% | 100% | |
4 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318724.1 | 100% | 100% | |
5 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318725.1 | 100% | 100% | |
6 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_016506.6 | 100% | 100% | |
7 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_018095.6 | 97% | 97% | 1_48del |
8 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318720.1 | 95.7% | 95.7% | 1_69del |
9 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318718.1 | 95.3% | 95.3% | 1_75del |
10 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318719.1 | 95.3% | 95.3% | 1_75del |
11 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | XM_017018009.1 | 94.1% | 94.1% | 1_96del |
12 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318717.1 | 92.9% | 92.9% | 1_117del |
13 | human | 55709 | KBTBD4 | kelch repeat and BTB domain... | NM_001318716.1 | 91.3% | 91.3% | 1_147del |
14 | mouse | 67136 | Kbtbd4 | kelch repeat and BTB (POZ) ... | NM_025991.3 | 91.7% | 99.4% | (many diffs) |
15 | mouse | 67136 | Kbtbd4 | kelch repeat and BTB (POZ) ... | XM_017319215.1 | 91.7% | 99.4% | (many diffs) |
16 | mouse | 67136 | Kbtbd4 | kelch repeat and BTB (POZ) ... | NM_001311116.1 | 89% | 96.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1620
- ORF length:
- 1554
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga atcaccagag gagcctggag catccatgga tgagaactac tttgtgaact 121 acactttcaa agatcggtca cattcaggcc gtgtggctca aggcatcatg aaactgtgtc 181 tagaggagga gctctttgct gatgtcacca tttcggtgga aggccgggag tttcagctcc 241 atcggctggt cctctcagct cagagctgct tcttccgatc catgttcact tccaacctga 301 aggaggccca caaccgggtg attgtgctgc aggatgtcag cgagtctgtt ttccagctcc 361 tggttgatta tatctaccat gggactgtga aacttcgagc tgaggagttg caggaaattt 421 atgaggtgtc agacatgtat cagctgacat ctctctttga ggaatgctct cggtttttgg 481 cccgcacagt gcaagtggga aactgccttc aggtgatgtg gctggcagat cggcacagtg 541 atcctgagct ctatacggct gccaagcact gtgccaagac ccacctggcc cagctgcaga 601 atacagagga atttctccac ttgccccacc gcttactcac agatatcatc tcggatggag 661 ttccgtgttc tcagaaccca acagaggcaa tagaagcctg gatcaacttt aataaagagg 721 aaagagaggc ttttgcagag tcactcagga caagcttgaa ggaaattggg gagaatgtgc 781 acatttacct gattgggaaa gagtcatctc gtacccactc gttggctgtg tccttgcact 841 gtgcagaaga tgactccatc agtgtaagtg gccaaaacag tttgtgccac cagatcactg 901 cggcctgcaa gcatggtgga gacttgtatg tggtgggagg gtccatccca cggcgcatgt 961 ggaagtgcaa caatgccacc gttgactggg agtggtgtgc tcctttgcct cgggaccggc 1021 tccagcacac cctggtgtct gtgcccggga aagatgccat atattcactg ggtggcaaga 1081 cactgcaaga taccctctcc aacgcagtca tttattatcg cgtaggtgat aatgtgtgga 1141 cagagacaac TCAGCTAGAG GTGGCTGTGT CAGGGGCTGC TGGTGCCAAC CTCAACGGGA 1201 TCATCTACTT ACTAGGGGGG GAGGAGAATG ATCTGGACTT CTTTACCAAA CCTTCCCGAC 1261 TCATCCAGTG CTTTGACACA GAGACAGACA AATGCCATGT GAAGCCCTAT GTGCTGCCCT 1321 TTGCAGGCCG CATGCACGCA GCTGTGCATA AAGATCTGGT GTTCATCGTG GCTGAAGGGG 1381 ACTCCCTGGT GTGCTACAAT CCCTTGCTAG ACAGCTTCAC CCGGCTTTGC CTTCCTGAGG 1441 CCTGGAGCTC TGCCCCATCC CTCTGGAAGA TTGCCAGCTG TAACGGGAGC ATCTATGTCT 1501 TCCGGGACCG ATATAAAAAG GGGGATGCCA ACACCTACAA GCTTGACCCT GCCACTTCAG 1561 CCGTAACTGT CACAAGAGGT ATTAAGGTGC TGCTTACCAA TTTGCAGTTT GTGTTGGCCT 1621 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1681 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1741 TTTATATATC TTGTGGAAAG GACGAGTCGC TACTGCAAAC CAGACACGGA CGCGTTAAGT 1801 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt