Transcript: Human NM_001318736.1

Homo sapiens coiled-coil domain containing 82 (CCDC82), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
CCDC82 (79780)
Length:
2881
CDS:
350..1984

Additional Resources:

NCBI RefSeq record:
NM_001318736.1
NBCI Gene record:
CCDC82 (79780)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430766 ACGCAGTAGTGGTAGAGATTT pLKO_005 1111 CDS 100% 13.200 18.480 N CCDC82 n/a
2 TRCN0000435881 GTTGATTGGAGGCGAACTAAA pLKO_005 419 CDS 100% 13.200 18.480 N CCDC82 n/a
3 TRCN0000129823 CAAGTGAATGAGCTGTTGATA pLKO.1 2256 3UTR 100% 5.625 3.938 N CCDC82 n/a
4 TRCN0000127543 CCAGGACCATGCAAATAGATA pLKO.1 1686 CDS 100% 5.625 3.938 N CCDC82 n/a
5 TRCN0000129904 GCCGTACCAGAATTTATCATA pLKO.1 1758 CDS 100% 5.625 3.938 N CCDC82 n/a
6 TRCN0000128463 GAAGAGCTTGATAGTGAAGAA pLKO.1 473 CDS 100% 4.950 3.465 N CCDC82 n/a
7 TRCN0000128006 GAGTCTTTCAACCCTCACATT pLKO.1 2574 3UTR 100% 4.950 3.465 N CCDC82 n/a
8 TRCN0000129929 GATGAAGAGCTTGATAGTGAT pLKO.1 503 CDS 100% 4.950 3.465 N CCDC82 n/a
9 TRCN0000130855 GCTGTTGATATCCTGTCAGTT pLKO.1 2267 3UTR 100% 4.950 3.465 N CCDC82 n/a
10 TRCN0000412553 GTGAAAGAGAGCTCAACTTAA pLKO_005 591 CDS 100% 13.200 7.920 N CCDC82 n/a
11 TRCN0000130856 GATAGTAACAAGGGACCTGAT pLKO.1 551 CDS 100% 4.050 2.430 N CCDC82 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12616 pDONR223 100% 62.5% 60.8% None (many diffs) n/a
2 ccsbBroad304_12616 pLX_304 0% 62.5% 60.8% V5 (many diffs) n/a
3 TRCN0000472780 CCTAACGTGGAAGGAAAGCCTGCG pLX_317 52.3% 62.5% 60.8% V5 (many diffs) n/a
Download CSV