Transcript: Human NM_001318768.1

Homo sapiens mitochondrial ribosomal protein L14 (MRPL14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
MRPL14 (64928)
Length:
898
CDS:
72..509

Additional Resources:

NCBI RefSeq record:
NM_001318768.1
NBCI Gene record:
MRPL14 (64928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172839 GAGTCTGAGTGCGATTCAGAA pLKO.1 152 CDS 100% 0.495 0.396 N MRPL14 n/a
2 TRCN0000234693 TCGCTGCATCCATGTCTATAA pLKO_005 236 CDS 100% 13.200 9.240 N MRPL14 n/a
3 TRCN0000234692 GTGCTGAGCCATCACTGTTTC pLKO_005 120 CDS 100% 10.800 7.560 N MRPL14 n/a
4 TRCN0000234695 TGGCCATTGCTCAGAACTTTG pLKO_005 484 CDS 100% 10.800 7.560 N MRPL14 n/a
5 TRCN0000234696 TGGTTGCAGGACTCGTGAATG pLKO_005 526 3UTR 100% 10.800 7.560 N MRPL14 n/a
6 TRCN0000234694 GCAAGCGGGAAGGCGAGTATT pLKO_005 454 CDS 100% 4.400 3.080 N MRPL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318768.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03985 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03985 pLX_304 0% 100% 100% V5 n/a
Download CSV