Transcript: Human NM_001318825.2

Homo sapiens hexosaminidase subunit alpha (HEXA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
HEXA (3073)
Length:
4818
CDS:
43..1665

Additional Resources:

NCBI RefSeq record:
NM_001318825.2
NBCI Gene record:
HEXA (3073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275314 TGGATGTCATGGCGTACAATA pLKO_005 644 CDS 100% 13.200 18.480 N HEXA n/a
2 TRCN0000029288 GTTGGATACATCTCGCCATTA pLKO.1 594 CDS 100% 10.800 15.120 N HEXA n/a
3 TRCN0000275354 TGGAGTCAGTGGAGAATTATA pLKO_005 404 CDS 100% 15.000 10.500 N HEXA n/a
4 TRCN0000275315 TATCTCCAAGGCGTTGGTATA pLKO_005 2090 3UTR 100% 10.800 7.560 N HEXA n/a
5 TRCN0000029285 CCATAAATGATGACCAGTGTT pLKO.1 431 CDS 100% 4.950 3.465 N HEXA n/a
6 TRCN0000029284 CCCAGTCTCAATAATACCTAT pLKO.1 949 CDS 100% 4.950 3.465 N HEXA n/a
7 TRCN0000275369 CCCAGTCTCAATAATACCTAT pLKO_005 949 CDS 100% 4.950 3.465 N HEXA n/a
8 TRCN0000029286 CGTCCTTTACCCGAACAACTT pLKO.1 153 CDS 100% 4.950 3.465 N HEXA n/a
9 TRCN0000275317 CGTCCTTTACCCGAACAACTT pLKO_005 153 CDS 100% 4.950 3.465 N HEXA n/a
10 TRCN0000029287 GCGAGAGGATATTCCAGTGAA pLKO.1 1251 CDS 100% 4.950 3.465 N HEXA n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2760 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2760 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318825.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06359 pDONR223 100% 97.7% 97.7% None (many diffs) n/a
2 ccsbBroad304_06359 pLX_304 0% 97.7% 97.7% V5 (many diffs) n/a
3 TRCN0000473984 CTGCACCGGGTTGCCTGAGCTTTC pLX_317 31.8% 97.7% 97.7% V5 (many diffs) n/a
Download CSV