Transcript: Human NM_001318844.2

Homo sapiens SNW domain containing 1 (SNW1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SNW1 (22938)
Length:
2209
CDS:
30..1745

Additional Resources:

NCBI RefSeq record:
NM_001318844.2
NBCI Gene record:
SNW1 (22938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293185 GGAGCTAAACAGAGGGTTATT pLKO_005 600 CDS 100% 13.200 18.480 N SNW1 n/a
2 TRCN0000001106 CCTAGCCGAAAGATGACTGTA pLKO.1 726 CDS 100% 4.950 6.930 N SNW1 n/a
3 TRCN0000293186 GCCCGATGAAGAAGCTATTAA pLKO_005 431 CDS 100% 15.000 10.500 N SNW1 n/a
4 TRCN0000001107 GAACAACAAGAGTGGAAGATT pLKO.1 750 CDS 100% 5.625 3.938 N SNW1 n/a
5 TRCN0000293184 GAACAACAAGAGTGGAAGATT pLKO_005 750 CDS 100% 5.625 3.938 N SNW1 n/a
6 TRCN0000001104 ACAGGTCTCTCCAAAGTGAAT pLKO.1 1723 CDS 100% 4.950 3.465 N SNW1 n/a
7 TRCN0000298470 ACAGGTCTCTCCAAAGTGAAT pLKO_005 1723 CDS 100% 4.950 3.465 N SNW1 n/a
8 TRCN0000001108 CCCAAGGAACACGAGCATGAA pLKO.1 1676 CDS 100% 4.950 3.465 N SNW1 n/a
9 TRCN0000293243 CCCAAGGAACACGAGCATGAA pLKO_005 1676 CDS 100% 4.950 3.465 N SNW1 n/a
10 TRCN0000001105 CCAGAATAAAGACCAACAGAT pLKO.1 1423 CDS 100% 4.950 2.970 N SNW1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318844.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07820 pDONR223 100% 93.7% 83.6% None (many diffs) n/a
2 ccsbBroad304_07820 pLX_304 0% 93.7% 83.6% V5 (many diffs) n/a
3 TRCN0000474558 CGAGGGTATCGTATTACATGAACT pLX_317 23.1% 93.7% 83.6% V5 (many diffs) n/a
Download CSV