Transcript: Human NM_001318976.1

Homo sapiens TATA-box binding protein associated factor, RNA polymerase I subunit B (TAF1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TAF1B (9014)
Length:
2282
CDS:
842..1843

Additional Resources:

NCBI RefSeq record:
NM_001318976.1
NBCI Gene record:
TAF1B (9014)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013332 CCTACGGTATTAGAAGATAAT pLKO.1 624 5UTR 100% 13.200 18.480 N TAF1B n/a
2 TRCN0000318851 CCTACGGTATTAGAAGATAAT pLKO_005 624 5UTR 100% 13.200 18.480 N TAF1B n/a
3 TRCN0000013329 CCCAACATACTGTGTATGAAA pLKO.1 986 CDS 100% 5.625 3.938 N TAF1B n/a
4 TRCN0000013330 GCCTTAAAGAACCTTGGAGTA pLKO.1 498 5UTR 100% 4.050 2.835 N TAF1B n/a
5 TRCN0000318844 GCCTTAAAGAACCTTGGAGTA pLKO_005 498 5UTR 100% 4.050 2.835 N TAF1B n/a
6 TRCN0000013328 GCAGGTGAGCTTCATTTGATT pLKO.1 2010 3UTR 100% 5.625 3.375 N TAF1B n/a
7 TRCN0000318781 GCAGGTGAGCTTCATTTGATT pLKO_005 2010 3UTR 100% 5.625 3.375 N TAF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07337 pDONR223 100% 56.4% 56.2% None (many diffs) n/a
2 ccsbBroad304_07337 pLX_304 0% 56.4% 56.2% V5 (many diffs) n/a
3 TRCN0000475393 CCCTTGACTGGCCGTATATAGAGC pLX_317 28.4% 56.4% 33.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV