Transcript: Human NM_001318977.1

Homo sapiens TATA-box binding protein associated factor, RNA polymerase I subunit B (TAF1B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TAF1B (9014)
Length:
2152
CDS:
712..1713

Additional Resources:

NCBI RefSeq record:
NM_001318977.1
NBCI Gene record:
TAF1B (9014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013332 CCTACGGTATTAGAAGATAAT pLKO.1 494 5UTR 100% 13.200 18.480 N TAF1B n/a
2 TRCN0000318851 CCTACGGTATTAGAAGATAAT pLKO_005 494 5UTR 100% 13.200 18.480 N TAF1B n/a
3 TRCN0000013331 GCCACAATGTTACAGAGAGAT pLKO.1 201 5UTR 100% 4.950 6.930 N TAF1B n/a
4 TRCN0000318843 GCCACAATGTTACAGAGAGAT pLKO_005 201 5UTR 100% 4.950 6.930 N TAF1B n/a
5 TRCN0000013329 CCCAACATACTGTGTATGAAA pLKO.1 856 CDS 100% 5.625 3.938 N TAF1B n/a
6 TRCN0000013330 GCCTTAAAGAACCTTGGAGTA pLKO.1 368 5UTR 100% 4.050 2.835 N TAF1B n/a
7 TRCN0000318844 GCCTTAAAGAACCTTGGAGTA pLKO_005 368 5UTR 100% 4.050 2.835 N TAF1B n/a
8 TRCN0000013328 GCAGGTGAGCTTCATTTGATT pLKO.1 1880 3UTR 100% 5.625 3.375 N TAF1B n/a
9 TRCN0000318781 GCAGGTGAGCTTCATTTGATT pLKO_005 1880 3UTR 100% 5.625 3.375 N TAF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07337 pDONR223 100% 56.4% 56.2% None (many diffs) n/a
2 ccsbBroad304_07337 pLX_304 0% 56.4% 56.2% V5 (many diffs) n/a
3 TRCN0000475393 CCCTTGACTGGCCGTATATAGAGC pLX_317 28.4% 56.4% 33.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV