Transcript: Human NM_001319052.1

Homo sapiens polypeptide N-acetylgalactosaminyltransferase 15 (GALNT15), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
GALNT15 (117248)
Length:
3333
CDS:
145..654

Additional Resources:

NCBI RefSeq record:
NM_001319052.1
NBCI Gene record:
GALNT15 (117248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035435 TGTCGGACATTCCACTGGTTT pLKO.1 178 CDS 100% 4.950 3.960 N GALNT15 n/a
2 TRCN0000423009 GATGATTGTCCACATTCTTTC pLKO_005 513 CDS 100% 10.800 7.560 N GALNT15 n/a
3 TRCN0000035434 GACCAGATCAATGCTGTGGAT pLKO.1 625 CDS 100% 2.640 1.848 N GALNT15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319052.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09447 pDONR223 100% 26.4% 26.4% None 0_1ins1410 n/a
2 ccsbBroad304_09447 pLX_304 0% 26.4% 26.4% V5 0_1ins1410 n/a
3 TRCN0000467061 ACGAAATATTGCTAAGACTAAATC pLX_317 18.3% 26.4% 26.4% V5 0_1ins1410 n/a
Download CSV