Transcript: Human NM_001319108.2

Homo sapiens oncostatin M (OSM), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
OSM (5008)
Length:
2461
CDS:
712..1407

Additional Resources:

NCBI RefSeq record:
NM_001319108.2
NBCI Gene record:
OSM (5008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058985 CGGGCTCAGGAACAACATCTA pLKO.1 1080 CDS 100% 4.950 6.930 N OSM n/a
2 TRCN0000058986 CCATCGCTTCATGCACTCAGT pLKO.1 1242 CDS 100% 2.640 2.112 N OSM n/a
3 TRCN0000378941 ACTTCCTCCTTTCCGTGTTTC pLKO_005 1794 3UTR 100% 10.800 7.560 N OSM n/a
4 TRCN0000373165 GGACCGACTTTCCATTGATTC pLKO_005 1662 3UTR 100% 10.800 7.560 N OSM n/a
5 TRCN0000378867 TGGTCCTTGCACTCCTGTTTC pLKO_005 686 5UTR 100% 10.800 7.560 N OSM n/a
6 TRCN0000378866 CTATAGGCAGCTGCTCGAAAG pLKO_005 728 CDS 100% 6.000 4.200 N OSM n/a
7 TRCN0000058983 GCCTGGATGTTCCTAAACTGA pLKO.1 839 CDS 100% 3.000 2.100 N OSM n/a
8 TRCN0000058987 CCTGCACAGACTGGCCGACTT pLKO.1 966 CDS 100% 0.000 0.000 N OSM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319108.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01126 pDONR223 100% 91.6% 91.6% None 0_1ins63 n/a
2 ccsbBroad304_01126 pLX_304 0% 91.6% 91.6% V5 0_1ins63 n/a
3 TRCN0000466753 TGTACGGGGTCCCTGCGTGTATGT pLX_317 51.4% 91.6% 91.6% V5 0_1ins63 n/a
Download CSV