Transcript: Human NM_001319157.1

Homo sapiens dynein light chain roadblock-type 1 (DYNLRB1), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
DYNLRB1 (83658)
Length:
1114
CDS:
76..441

Additional Resources:

NCBI RefSeq record:
NM_001319157.1
NBCI Gene record:
DYNLRB1 (83658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156412 CAGAACGATCTCACCTTCCTT pLKO.1 262 CDS 100% 3.000 4.200 N DYNLRB1 n/a
2 TRCN0000297297 GAAGGGAGTGCAGGGAATCAT pLKO_005 117 CDS 100% 5.625 3.938 N DYNLRB1 n/a
3 TRCN0000297250 AGCCTCATGCACAGCTTCATC pLKO_005 205 CDS 100% 4.950 3.465 N DYNLRB1 n/a
4 TRCN0000156977 CAGAAGGCATTCCCATCAAGA pLKO.1 149 CDS 100% 4.950 3.465 N DYNLRB1 n/a
5 TRCN0000158221 CATCAAGAGCACCATGGACAA pLKO.1 162 CDS 100% 4.050 2.835 N DYNLRB1 n/a
6 TRCN0000158120 CATGCACAGCTTCATCCTGAA pLKO.1 210 CDS 100% 4.050 2.835 N DYNLRB1 n/a
7 TRCN0000156511 GAACACAGAAGGCATTCCCAT pLKO.1 144 CDS 100% 2.640 1.848 N DYNLRB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09104 pDONR223 100% 77.1% 65.6% None (many diffs) n/a
2 ccsbBroad304_09104 pLX_304 0% 77.1% 65.6% V5 (many diffs) n/a
3 TRCN0000470696 GCATTTATTTACTCTGACATATGC pLX_317 60.3% 77.1% 65.6% V5 (many diffs) n/a
Download CSV