Transcript: Human NM_001319162.2

Homo sapiens cytochrome P450 family 4 subfamily B member 1 (CYP4B1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CYP4B1 (1580)
Length:
1987
CDS:
339..1388

Additional Resources:

NCBI RefSeq record:
NM_001319162.2
NBCI Gene record:
CYP4B1 (1580)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126061 CCAGTACCATAATGACTTCAT pLKO.1 539 CDS 100% 4.950 6.930 N Cyp4b1 n/a
2 TRCN0000064247 CTTAGGCTTTCTCAAGCTCAT pLKO.1 105 5UTR 100% 4.050 5.670 N CYP4B1 n/a
3 TRCN0000064245 CCTGATCTCTATGCATATCTA pLKO.1 1061 CDS 100% 5.625 3.938 N CYP4B1 n/a
4 TRCN0000064243 CGGGATGAAGATGACATCAAA pLKO.1 729 CDS 100% 5.625 3.938 N CYP4B1 n/a
5 TRCN0000064246 GTTTGCCATGAGTGAGATGAA pLKO.1 1223 CDS 100% 4.950 2.970 N CYP4B1 n/a
6 TRCN0000126062 CAGTACCATAATGACTTCATT pLKO.1 540 CDS 100% 5.625 3.938 N Cyp4b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00413 pDONR223 100% 68.1% 68.1% None 0_1ins489 n/a
2 ccsbBroad304_00413 pLX_304 0% 68.1% 68.1% V5 0_1ins489 n/a
3 TRCN0000472546 CAACACCTACATCGAGTACAAGCA pLX_317 28% 68.1% 68.1% V5 0_1ins489 n/a
Download CSV