Transcript: Human NM_001319205.2

Homo sapiens proopiomelanocortin (POMC), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
POMC (5443)
Length:
1158
CDS:
134..937

Additional Resources:

NCBI RefSeq record:
NM_001319205.2
NBCI Gene record:
POMC (5443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001319205.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358679 ACTCCCATGTTCCCGGGAAAT pLKO_005 305 CDS 100% 10.800 8.640 N POMC n/a
2 TRCN0000083770 GAAGTACGTCATGGGCCACTT pLKO.1 358 CDS 100% 4.050 3.240 N POMC n/a
3 TRCN0000358651 CCAGTGAAGGTGTACCCTAAC pLKO_005 599 CDS 100% 6.000 4.200 N POMC n/a
4 TRCN0000358591 CATCATCAAGAACGCCTACAA pLKO_005 904 CDS 100% 4.950 3.465 N POMC n/a
5 TRCN0000083771 CCATCATCAAGAACGCCTACA pLKO.1 903 CDS 100% 4.050 2.835 N POMC n/a
6 TRCN0000083768 CGGTTTCATGACCTCCGAGAA pLKO.1 847 CDS 100% 4.050 2.835 N POMC n/a
7 TRCN0000358589 CTCCTACTCCATGGAGCACTT pLKO_005 544 CDS 100% 4.050 2.835 N POMC n/a
8 TRCN0000083769 GACTCCCATGTTCCCGGGAAA pLKO.1 304 CDS 100% 1.350 0.945 N POMC n/a
9 TRCN0000083772 CACCACGGAAAGCAACCTGCT pLKO.1 244 CDS 100% 0.720 0.504 N POMC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001319205.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01245 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01245 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476769 ACTACTACAACTCTGCGTTAACTC pLX_317 48.3% 100% 100% V5 n/a
Download CSV