Transcript: Human NM_001320035.2

Homo sapiens GRAM domain containing 1A (GRAMD1A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
GRAMD1A (57655)
Length:
2534
CDS:
746..2206

Additional Resources:

NCBI RefSeq record:
NM_001320035.2
NBCI Gene record:
GRAMD1A (57655)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320035.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427036 ACGGAACCGAGATGCACTTTA pLKO_005 2352 3UTR 100% 13.200 18.480 N GRAMD1A n/a
2 TRCN0000423358 AGCGGCATTGAAGACTATTTC pLKO_005 1592 CDS 100% 13.200 18.480 N GRAMD1A n/a
3 TRCN0000136082 GCGAGAAGCATTTCTTCACTT pLKO.1 674 5UTR 100% 4.950 6.930 N GRAMD1A n/a
4 TRCN0000423618 CCGAAGCAGAACGCCTCATTG pLKO_005 458 5UTR 100% 3.600 2.880 N GRAMD1A n/a
5 TRCN0000136936 CGCTCATTGAGAAGAACTCGT pLKO.1 1569 CDS 100% 2.640 2.112 N GRAMD1A n/a
6 TRCN0000430867 ATGCAGAGCTGGTACAGTATG pLKO_005 379 5UTR 100% 10.800 7.560 N GRAMD1A n/a
7 TRCN0000135074 CCCACTTATAAGCAGCGTAAT pLKO.1 406 5UTR 100% 10.800 7.560 N GRAMD1A n/a
8 TRCN0000135911 GAAGTCGCTCATTGAGAAGAA pLKO.1 1564 CDS 100% 4.950 3.465 N GRAMD1A n/a
9 TRCN0000135216 CAGACACAAGTAACTCCTCTT pLKO.1 1074 CDS 100% 4.050 2.835 N GRAMD1A n/a
10 TRCN0000135376 GTGACATGTCTGAAGAAGGAA pLKO.1 607 5UTR 100% 3.000 2.100 N GRAMD1A n/a
11 TRCN0000136423 CTGCTTCTACAGCAACATCTT pLKO.1 549 5UTR 100% 4.950 2.475 Y GRAMD1A n/a
12 TRCN0000192431 CGGAAACTGTTCAGCAAACTT pLKO.1 436 5UTR 100% 5.625 3.938 N Gramd1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320035.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.