Transcript: Human NM_001320274.2

Homo sapiens ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 5 (ST6GALNAC5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ST6GALNAC5 (81849)
Length:
5029
CDS:
197..496

Additional Resources:

NCBI RefSeq record:
NM_001320274.2
NBCI Gene record:
ST6GALNAC5 (81849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035092 CGGACATTCAATATTCACTTT pLKO.1 603 3UTR 100% 4.950 3.960 N ST6GALNAC5 n/a
2 TRCN0000414822 GCCTTTGAAACTGCAACATAA pLKO_005 985 3UTR 100% 13.200 9.240 N ST6GALNAC5 n/a
3 TRCN0000035089 GCTATAAATCATCCTGAGAAT pLKO.1 654 3UTR 100% 4.950 3.465 N ST6GALNAC5 n/a
4 TRCN0000437387 GGCAGTCATCACCGCTTTATC pLKO_005 552 3UTR 100% 13.200 7.920 N ST6GALNAC5 n/a
5 TRCN0000035091 GAAACCAGAATCACTTGCTAT pLKO.1 638 3UTR 100% 4.950 2.970 N ST6GALNAC5 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1901 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320274.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04258 pDONR223 100% 27.7% 26.1% None (many diffs) n/a
2 ccsbBroad304_04258 pLX_304 0% 27.7% 26.1% V5 (many diffs) n/a
3 TRCN0000466231 GACTTACACAGACTGATTATAATA pLX_317 40.6% 27.7% 26.1% V5 (many diffs) n/a
Download CSV