Transcript: Human NM_001320276.1

Homo sapiens FYVE, RhoGEF and PH domain containing 5 (FGD5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
FGD5 (152273)
Length:
5768
CDS:
111..4370

Additional Resources:

NCBI RefSeq record:
NM_001320276.1
NBCI Gene record:
FGD5 (152273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435125 GTGCTCCTCACAGACTATTTA pLKO_005 3252 CDS 100% 15.000 21.000 N FGD5 n/a
2 TRCN0000048243 CCACCCAGTAATAAACTATTT pLKO.1 4610 3UTR 100% 13.200 18.480 N FGD5 n/a
3 TRCN0000048247 CCTGGCACTGACGTTTAAGAA pLKO.1 2078 CDS 100% 5.625 7.875 N FGD5 n/a
4 TRCN0000048245 CCGGCACCTATTTCTGATGAA pLKO.1 3500 CDS 100% 4.950 6.930 N FGD5 n/a
5 TRCN0000427439 GCAGCTGCTGTCCGTGAATTT pLKO_005 3153 CDS 100% 13.200 10.560 N FGD5 n/a
6 TRCN0000048246 CCTCTTTCTGAATCAGCGAAA pLKO.1 1200 CDS 100% 4.050 3.240 N FGD5 n/a
7 TRCN0000048244 GCAGTGAAGTAGGACCTATTT pLKO.1 4246 CDS 100% 13.200 9.240 N FGD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320276.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13286 pDONR223 100% 33.9% 33.9% None 1_2766del;2943G>T;4065_4066ins129 n/a
2 ccsbBroad304_13286 pLX_304 0% 33.9% 33.9% V5 1_2766del;2943G>T;4065_4066ins129 n/a
3 TRCN0000471906 GCCCGGTTATATCTATATCTCTAT pLX_317 27.6% 33.9% 33.9% V5 1_2766del;2943G>T;4065_4066ins129 n/a
Download CSV