Transcript: Human NM_001320302.1

Homo sapiens family with sequence similarity 78 member B (FAM78B), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
FAM78B (149297)
Length:
5524
CDS:
508..825

Additional Resources:

NCBI RefSeq record:
NM_001320302.1
NBCI Gene record:
FAM78B (149297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180966 GATGGAGTTCTTCAACACCTA pLKO.1 735 CDS 100% 2.640 1.848 N Fam78b n/a
2 TRCN0000172942 GAGAACATCGTGGTGTACGAT pLKO.1 553 CDS 100% 0.300 0.210 N FAM78B n/a
3 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2915 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320302.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09661 pDONR223 100% 38% 33.9% None (many diffs) n/a
2 ccsbBroad304_09661 pLX_304 0% 38% 33.9% V5 (many diffs) n/a
3 TRCN0000477892 AAATTTCACGTCACTCGCACAGCT pLX_317 48.6% 38% 33.9% V5 (many diffs) n/a
Download CSV