Transcript: Human NM_001320542.2

Homo sapiens chromosome 16 open reading frame 70 (C16orf70), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
C16orf70 (80262)
Length:
2788
CDS:
107..1375

Additional Resources:

NCBI RefSeq record:
NM_001320542.2
NBCI Gene record:
C16orf70 (80262)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162918 GATGCCAAGATGCGGGTATTT pLKO.1 791 CDS 100% 13.200 18.480 N C16orf70 n/a
2 TRCN0000159278 GTTTGTTCTACACACCAATTA pLKO.1 1024 CDS 100% 13.200 18.480 N C16orf70 n/a
3 TRCN0000420237 TAGTACTTGGTTGCGACATTT pLKO_005 1815 3UTR 100% 13.200 18.480 N C16orf70 n/a
4 TRCN0000433452 TCCAAAGTATGAGCCCAATTT pLKO_005 544 CDS 100% 13.200 18.480 N C16orf70 n/a
5 TRCN0000161851 GACATCCTCTTTGATGCGAAT pLKO.1 986 CDS 100% 4.050 3.240 N C16orf70 n/a
6 TRCN0000161274 GCGAATGATCTTTGAGGTCAT pLKO.1 1273 CDS 100% 4.050 3.240 N C16orf70 n/a
7 TRCN0000416116 ATTACCCTGGGCATTATAATT pLKO_005 1041 CDS 100% 15.000 10.500 N C16orf70 n/a
8 TRCN0000412711 CAAGTTCCATCGAAGTGTAAT pLKO_005 932 CDS 100% 13.200 9.240 N C16orf70 n/a
9 TRCN0000418086 ACCCAGGAGCTCTCAACTAAC pLKO_005 1638 3UTR 100% 10.800 7.560 N C16orf70 n/a
10 TRCN0000425620 ATGATGCCTCTGAGCTGTTTC pLKO_005 662 CDS 100% 10.800 7.560 N C16orf70 n/a
11 TRCN0000423853 TGACTCAGGACGGGATCAAAC pLKO_005 285 CDS 100% 10.800 7.560 N C16orf70 n/a
12 TRCN0000162515 CAACCCATTTGGTTCCACATT pLKO.1 1237 CDS 100% 4.950 3.465 N C16orf70 n/a
13 TRCN0000160990 GCCAAAGACATCTTCCTACTT pLKO.1 2110 3UTR 100% 4.950 3.465 N C16orf70 n/a
14 TRCN0000164306 CCAACCCATTTGGTTCCACAT pLKO.1 1236 CDS 100% 4.050 2.835 N C16orf70 n/a
15 TRCN0000160023 CCACACAAAGTCTTCTATAAA pLKO.1 869 CDS 100% 15.000 9.000 N C16orf70 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320542.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04198 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04198 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480083 GCGGAGGCGCGCTACTGTGAGAAA pLX_317 27.3% 100% 100% V5 n/a
Download CSV