Transcript: Human NM_001320737.1

Homo sapiens family with sequence similarity 107 member B (FAM107B), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
FAM107B (83641)
Length:
3377
CDS:
322..717

Additional Resources:

NCBI RefSeq record:
NM_001320737.1
NBCI Gene record:
FAM107B (83641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167743 GATGACAATCCTGAACTCATT pLKO.1 346 CDS 100% 4.950 6.930 N FAM107B n/a
2 TRCN0000167245 CGAAGAATTGTTGAGGATTTA pLKO.1 2057 3UTR 100% 13.200 9.240 N FAM107B n/a
3 TRCN0000167505 GACTTGGAAATAGAGCTATTA pLKO.1 556 CDS 100% 13.200 9.240 N FAM107B n/a
4 TRCN0000433697 ACCTGTGTTCAGAGACTTAAC pLKO_005 948 3UTR 100% 10.800 7.560 N FAM107B n/a
5 TRCN0000421525 CCGAGTTTGTGAAGGTGAAAG pLKO_005 647 CDS 100% 10.800 7.560 N FAM107B n/a
6 TRCN0000167212 CATAAGGACTCATATCTCATT pLKO.1 289 5UTR 100% 4.950 3.465 N FAM107B n/a
7 TRCN0000191273 CTTGAACTTGAGAAGCAGAAA pLKO.1 601 CDS 100% 4.950 2.970 N Fam107b n/a
8 TRCN0000314464 CTTGAACTTGAGAAGCAGAAA pLKO_005 601 CDS 100% 4.950 2.970 N Fam107b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320737.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12751 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12751 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473565 TTTGTCCGGTGACCGTGCAGACGA pLX_317 100% 100% 100% V5 n/a
Download CSV