Transcript: Human NM_001320821.2

Homo sapiens RAS p21 protein activator 3 (RASA3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
RASA3 (22821)
Length:
4669
CDS:
1750..3105

Additional Resources:

NCBI RefSeq record:
NM_001320821.2
NBCI Gene record:
RASA3 (22821)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428723 GAGACCTACAAGACGCTAAAG pLKO_005 2923 CDS 100% 10.800 15.120 N RASA3 n/a
2 TRCN0000001641 GACCTCCACTCATTCCATTTA pLKO.1 3084 CDS 100% 13.200 10.560 N RASA3 n/a
3 TRCN0000429712 GCTTTCGGCTTCATCACATTG pLKO_005 3571 3UTR 100% 10.800 8.640 N RASA3 n/a
4 TRCN0000001638 CCAAGTCCAAATCTGCGAGTT pLKO.1 2177 CDS 100% 4.050 3.240 N RASA3 n/a
5 TRCN0000426739 GAGCAGCCCATCGTGCTTAAA pLKO_005 2317 CDS 100% 13.200 9.240 N RASA3 n/a
6 TRCN0000412788 AGACGTGGACAAGCTCGAAAT pLKO_005 1257 5UTR 100% 10.800 7.560 N RASA3 n/a
7 TRCN0000001639 ACCTGAAGTTTGGAGATGAAT pLKO.1 1304 5UTR 100% 5.625 3.938 N RASA3 n/a
8 TRCN0000001640 AGCAAAGAAGACGAAAGTGAA pLKO.1 1137 5UTR 100% 4.950 3.465 N RASA3 n/a
9 TRCN0000438059 AGTCTCGTGCACGTCTGTCTT pLKO_005 3482 3UTR 100% 4.950 3.465 N RASA3 n/a
10 TRCN0000001637 CCAGTATAAGAGGGACAAGTT pLKO.1 2985 CDS 100% 4.950 3.465 N RASA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320821.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07803 pDONR223 100% 54% 54% None 0_1ins1149;177T>C n/a
2 ccsbBroad304_07803 pLX_304 0% 54% 54% V5 0_1ins1149;177T>C n/a
3 TRCN0000477981 CCTGTTTCCCCCGACCCTGAGTCG pLX_317 14.6% 54% 54% V5 0_1ins1149;177T>C n/a
Download CSV