Transcript: Human NM_001320846.1

Homo sapiens spermidine/spermine N1-acetyltransferase family member 2 (SAT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
SAT2 (112483)
Length:
919
CDS:
22..669

Additional Resources:

NCBI RefSeq record:
NM_001320846.1
NBCI Gene record:
SAT2 (112483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303583 AGGATCTCTGTCTTGAGTTTC pLKO_005 683 3UTR 100% 10.800 7.560 N SAT2 n/a
2 TRCN0000035207 TGGCACTTCTTCTGCTTTCAA pLKO.1 616 CDS 100% 5.625 3.938 N SAT2 n/a
3 TRCN0000333358 TGGCACTTCTTCTGCTTTCAA pLKO_005 616 CDS 100% 5.625 3.938 N SAT2 n/a
4 TRCN0000035206 GATCAGGTGAAGATCAGTGAA pLKO.1 352 CDS 100% 4.950 3.465 N SAT2 n/a
5 TRCN0000315887 GATCAGGTGAAGATCAGTGAA pLKO_005 352 CDS 100% 4.950 3.465 N SAT2 n/a
6 TRCN0000035205 CCTTTCTATCACTGTTTGGTA pLKO.1 406 CDS 100% 3.000 2.100 N SAT2 n/a
7 TRCN0000035208 CACTGTTTGGTAGCAGAGATT pLKO.1 415 CDS 100% 4.950 2.970 N SAT2 n/a
8 TRCN0000349180 CACTGTTTGGTAGCAGAGATT pLKO_005 415 CDS 100% 4.950 2.970 N SAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04628 pDONR223 100% 54.6% 47.4% None 1_220del;286_302del;437_438ins102 n/a
2 ccsbBroad304_04628 pLX_304 0% 54.6% 47.4% V5 1_220del;286_302del;437_438ins102 n/a
3 TRCN0000468190 TAGCCGCTTAGAGCGAACATTCCT pLX_317 70% 54.6% 47.4% V5 1_220del;286_302del;437_438ins102 n/a
Download CSV