Transcript: Human NM_001320867.2

Homo sapiens ETHE1 persulfide dioxygenase (ETHE1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ETHE1 (23474)
Length:
887
CDS:
25..756

Additional Resources:

NCBI RefSeq record:
NM_001320867.2
NBCI Gene record:
ETHE1 (23474)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425757 GTCACCTTCGTCCTGAATGAC pLKO_005 409 CDS 100% 4.950 6.930 N ETHE1 n/a
2 TRCN0000083456 TCCAGGAGACTGTCTGATCTA pLKO.1 546 CDS 100% 4.950 6.930 N ETHE1 n/a
3 TRCN0000429446 TCTGTCATCTCCCGCCTTAGT pLKO_005 289 CDS 100% 4.950 3.960 N ETHE1 n/a
4 TRCN0000083453 GCTGACTTACACATTGAGGAT pLKO.1 319 CDS 100% 2.640 2.112 N ETHE1 n/a
5 TRCN0000083457 CTTGCCTAAACCTCAGCAGAT pLKO.1 681 CDS 100% 4.050 2.835 N ETHE1 n/a
6 TRCN0000083455 TGCTCACGATTACCATGGGTT pLKO.1 570 CDS 100% 2.640 1.848 N ETHE1 n/a
7 TRCN0000083454 CAGCAGATAGACTTTGCTGTT pLKO.1 694 CDS 100% 0.405 0.284 N ETHE1 n/a
8 TRCN0000428684 AGCTGTGAGGAGTTTGTCAAA pLKO_005 643 CDS 100% 4.950 2.970 N ETHE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320867.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02774 pDONR223 100% 95.6% 95.6% None 225_226ins33 n/a
2 ccsbBroad304_02774 pLX_304 0% 95.6% 95.6% V5 225_226ins33 n/a
3 TRCN0000471100 ATTGCTCTTCACTATCCAATAACT pLX_317 57.8% 95.6% 95.6% V5 225_226ins33 n/a
Download CSV