Transcript: Human NM_001321122.1

Homo sapiens lactotransferrin (LTF), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
LTF (4057)
Length:
2881
CDS:
569..2662

Additional Resources:

NCBI RefSeq record:
NM_001321122.1
NBCI Gene record:
LTF (4057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372806 CAGCCACGAACTCACTATTAT pLKO_005 845 CDS 100% 15.000 21.000 N LTF n/a
2 TRCN0000372872 GGGTCTGACCCGAGATCTAAT pLKO_005 2072 CDS 100% 13.200 18.480 N LTF n/a
3 TRCN0000047028 CGGTGCAGATAAAGGACAGTT pLKO.1 1063 CDS 100% 4.950 3.960 N LTF n/a
4 TRCN0000047030 GCAGGCATTACTAATCTGAAA pLKO.1 2591 CDS 100% 4.950 3.465 N LTF n/a
5 TRCN0000047031 GCCATCCAGAACTTGAGGAAA pLKO.1 1565 CDS 100% 4.950 3.465 N LTF n/a
6 TRCN0000047032 CCCTACAAACTGCGACCTGTA pLKO.1 797 CDS 100% 4.050 2.835 N LTF n/a
7 TRCN0000047029 CCTGATCCTAACTGTGTGGAT pLKO.1 1853 CDS 100% 2.640 1.848 N LTF n/a
8 TRCN0000372871 CCCAACAGCAACGAGAGATAC pLKO_005 2141 CDS 100% 10.800 6.480 N LTF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13895 pDONR223 100% 97.8% 97.7% None (many diffs) n/a
2 ccsbBroad304_13895 pLX_304 0% 97.8% 97.7% V5 (many diffs) n/a
3 TRCN0000491462 GTGGTCCAATTAAGTTACATCTTA pLX_317 17.9% 97.8% 97.7% V5 (many diffs) n/a
4 ccsbBroadEn_10953 pDONR223 100% 97.7% 97.6% None (many diffs) n/a
5 ccsbBroad304_10953 pLX_304 0% 97.7% 97.6% V5 (many diffs) n/a
6 TRCN0000472262 CGAATGAGCGGCAGATGCTAATGC pLX_317 10.7% 97.7% 97.6% V5 (many diffs) n/a
Download CSV