Transcript: Human NM_001321288.1

Homo sapiens autophagy related 4A cysteine peptidase (ATG4A), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
ATG4A (115201)
Length:
2359
CDS:
435..1400

Additional Resources:

NCBI RefSeq record:
NM_001321288.1
NBCI Gene record:
ATG4A (115201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321288.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416255 TGATATAAGTGCTCGTCTATG pLKO_005 344 5UTR 100% 10.800 15.120 N ATG4A n/a
2 TRCN0000073794 CGCGTATTATTTCATAGGATT pLKO.1 992 CDS 100% 4.950 6.930 N ATG4A n/a
3 TRCN0000433463 TTGCTACTCTATCCATCAAAT pLKO_005 575 CDS 100% 13.200 10.560 N ATG4A n/a
4 TRCN0000073795 CCTGGGCATAAACCAAATCAA pLKO.1 893 CDS 100% 5.625 4.500 N ATG4A n/a
5 TRCN0000180147 CCTGGGCATAAACCAAATCAA pLKO.1 893 CDS 100% 5.625 4.500 N Atg4a n/a
6 TRCN0000073796 CAGATACAGATGAGCTGGTAT pLKO.1 271 5UTR 100% 4.950 3.960 N ATG4A n/a
7 TRCN0000436397 GACAGGCCTCCCGATTCTTTA pLKO_005 795 CDS 100% 13.200 9.240 N ATG4A n/a
8 TRCN0000416712 TAGTCAGCAAGTGCCTGATAT pLKO_005 1478 3UTR 100% 13.200 9.240 N ATG4A n/a
9 TRCN0000432878 ACAGCGAATGAACATCCTAAA pLKO_005 1121 CDS 100% 10.800 7.560 N ATG4A n/a
10 TRCN0000424537 GATGCTGGCTCAAGCCCTTAT pLKO_005 455 CDS 100% 10.800 7.560 N ATG4A n/a
11 TRCN0000434188 TTAAGATGCCACAGTCTTTAG pLKO_005 946 CDS 100% 10.800 7.560 N ATG4A n/a
12 TRCN0000073793 CCCGGAAAGAAATAGAACAAT pLKO.1 1594 3UTR 100% 5.625 3.938 N ATG4A n/a
13 TRCN0000073797 CCAGATACAGATGAGCTGGTA pLKO.1 270 5UTR 100% 2.640 1.848 N ATG4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321288.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04675 pDONR223 100% 80.6% 80.6% None 0_1ins231 n/a
2 ccsbBroad304_04675 pLX_304 0% 80.6% 80.6% V5 0_1ins231 n/a
3 TRCN0000470578 AACGAGCTAATCGACGCCTGCCAG pLX_317 40.4% 80.6% 80.6% V5 0_1ins231 n/a
Download CSV