Construct: ORF TRCN0000470578
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016388.1_s317c1
- Derived from:
- ccsbBroadEn_04675
- DNA Barcode:
- AACGAGCTAATCGACGCCTGCCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ATG4A (115201)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470578
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 115201 | ATG4A | autophagy related 4A cystei... | NM_052936.5 | 100% | 100% | |
| 2 | human | 115201 | ATG4A | autophagy related 4A cystei... | NM_178270.3 | 84.4% | 84.4% | 628_629ins186 |
| 3 | human | 115201 | ATG4A | autophagy related 4A cystei... | NM_001321287.1 | 80.6% | 80.6% | 0_1ins231 |
| 4 | human | 115201 | ATG4A | autophagy related 4A cystei... | NM_001321288.1 | 80.6% | 80.6% | 0_1ins231 |
| 5 | human | 115201 | ATG4A | autophagy related 4A cystei... | NM_178271.2 | 80.6% | 80.6% | 0_1ins231 |
| 6 | human | 115201 | ATG4A | autophagy related 4A cystei... | XM_011530842.1 | 80.6% | 80.6% | 0_1ins231 |
| 7 | human | 115201 | ATG4A | autophagy related 4A cystei... | NM_001321289.1 | 65% | 65% | 0_1ins231;397_398ins186 |
| 8 | human | 115201 | ATG4A | autophagy related 4A cystei... | NM_001321290.1 | 56.7% | 56.7% | 0_1ins516 |
| 9 | human | 115201 | ATG4A | autophagy related 4A cystei... | NR_135608.1 | 49% | (many diffs) | |
| 10 | mouse | 666468 | Atg4a | autophagy related 4A, cyste... | NM_174875.3 | 89.2% | 91.7% | (many diffs) |
| 11 | mouse | 666468 | Atg4a | autophagy related 4A, cyste... | XM_017318601.1 | 88.4% | 90.7% | (many diffs) |
| 12 | mouse | 666468 | Atg4a | autophagy related 4A, cyste... | XM_017318602.1 | 88.4% | 90.7% | (many diffs) |
| 13 | mouse | 666468 | Atg4a | autophagy related 4A, cyste... | XM_017318599.1 | 76.4% | 78.5% | (many diffs) |
| 14 | mouse | 666468 | Atg4a | autophagy related 4A, cyste... | XM_017318603.1 | 72% | 74% | (many diffs) |
| 15 | mouse | 666468 | Atg4a | autophagy related 4A, cyste... | XM_017318600.1 | 71.5% | 73.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1260
- ORF length:
- 1194
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtcagtttta tccaagtatg aagatcagat tactattttc actgactacc 121 tagaagaata tccagataca gatgagctgg tatggatctt agggaagcag catctcctta 181 aaacagaaaa atctaagctg ttgtctgata taagtgctcg tctatggttt acatacagaa 241 ggaaattttc accaattggt ggaacgggcc cttcatcaga tgctggttgg ggatgtatgc 301 tacgctgtgg acagatgatg ctggctcaag cccttatctg tagacacttg ggaagggact 361 ggagctggga gaaacaaaaa gaacaaccca aagaatacca acgcatccta cagtgcttct 421 tagatagaaa agattgttgc tactctatcc atcaaatggc acaaatgggt gtaggagaag 481 ggaaatcaat tggagaatgg tttggaccaa atacagttgc acaggtgtta aaaaaacttg 541 ctttatttga cgaatggaat tccttggctg tttatgtttc aatggataac acagtggtca 601 ttgaagatat caaaaaaatg tgccgtgtcc ttcccttgag tgctgacaca gctggtgaca 661 ggcctcccga ttctttaact gcttcaaacc agagtaaggg cacctctgcc tactgctcag 721 cctggaaacc cctgctgctc attgtgcccc ttcgcctggg cataaaccaa atcaatcctG 781 TCTATGTTGA TGCATTCAAA GAGTGTTTTA AGATGCCACA GTCTTTAGGG GCATTAGGAG 841 GAAAACCAAA TAACGCGTAT TATTTCATAG GATTCTTAGG TGACGAGCTC ATCTTCTTGG 901 ACCCTCATAC AACCCAGACC TTTGTTGACA CTGAAGAGAA TGGAACGGTT AATGACCAGA 961 CTTTCCATTG CCTGCAGTCC CCACAGCGAA TGAACATCCT AAACCTGGAT CCTTCAGTTG 1021 CATTGGGATT TTTCTGCAAA GAAGAAAAAG ACTTTGATAA CTGGTGTAGC CTTGTTCAGA 1081 AGGAAATTCT AAAGGAGAAT TTAAGGATGT TTGAATTAGT TCAGAAACAT CCATCACACT 1141 GGCCTCCCTT TGTACCTCCA GCCAAGCCAG AAGTGACAAC CACTGGGGCA GAATTCATTG 1201 ACTCTACTGA GCAACTGGAG GAGTTTGATC TGGAGGAAGA TTTTGAGATT CTGAGTGTGT 1261 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1321 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1381 TTTATATATC TTGTGGAAAG GACGAAACGA GCTAATCGAC GCCTGCCAGA CGCGTTAAGT 1441 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt