Transcript: Human NM_001321400.1

Homo sapiens MAGE family member A2B (MAGEA2B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
MAGEA2B (266740)
Length:
2026
CDS:
526..1470

Additional Resources:

NCBI RefSeq record:
NM_001321400.1
NBCI Gene record:
MAGEA2B (266740)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141549 CTGGAGAGTGTCCTCAGAAAT pLKO.1 931 CDS 100% 13.200 6.600 Y MAGEA2B n/a
2 TRCN0000435819 GATAATCGTCCTGGCCATAAT pLKO_005 1131 CDS 100% 13.200 6.600 Y MAGEA2 n/a
3 TRCN0000134344 GATGGTTGAGTTGGTTCATTT pLKO.1 861 CDS 100% 13.200 6.600 Y MAGEA2 n/a
4 TRCN0000282137 GCCGGTCACAAAGGCAGAAAT pLKO_005 909 CDS 100% 13.200 6.600 Y MAGEA9B n/a
5 TRCN0000431510 TCGGTGGAGAACCTCACATTT pLKO_005 1403 CDS 100% 13.200 6.600 Y MAGEA2 n/a
6 TRCN0000435409 TGAGTATGTTGGAGGTGTTTG pLKO_005 1199 CDS 100% 10.800 5.400 Y MAGEA2 n/a
7 TRCN0000133743 CATTGAAACCAGCTATGTGAA pLKO.1 1359 CDS 100% 4.950 2.475 Y MAGEA2 n/a
8 TRCN0000152048 CATTGAAACCAGCTATGTGAA pLKO.1 1359 CDS 100% 4.950 2.475 Y MAGEA6 n/a
9 TRCN0000122116 CCTCATTGAAACCAGCTATGT pLKO.1 1356 CDS 100% 4.950 2.475 Y MAGEA2B n/a
10 TRCN0000128375 GAATGACAGTAGTCACACATA pLKO.1 1727 3UTR 100% 4.950 2.475 Y MAGEA3 n/a
11 TRCN0000144761 GATTGGGAAATCCATTCCATT pLKO.1 1793 3UTR 100% 4.950 2.475 Y MAGEA2B n/a
12 TRCN0000152384 GATTGGGAAATCCATTCCATT pLKO.1 1793 3UTR 100% 4.950 2.475 Y MAGEA6 n/a
13 TRCN0000121872 GCAGTGAGTTTCTGTTCTGTT pLKO.1 1613 3UTR 100% 4.950 2.475 Y MAGEA2B n/a
14 TRCN0000136874 CCTCAGAAATTGCCAGGACTT pLKO.1 942 CDS 100% 4.050 2.025 Y MAGEA2 n/a
15 TRCN0000127630 CTGATAATCGTCCTGGCCATA pLKO.1 1129 CDS 100% 4.050 2.025 Y MAGEA3 n/a
16 TRCN0000141126 CCAAGCAGCAATCAGTAGGAA pLKO.1 840 CDS 100% 3.000 1.500 Y MAGEA2B n/a
17 TRCN0000135953 GCAATCAGTAGGAAGATGGTT pLKO.1 847 CDS 100% 3.000 1.500 Y MAGEA2 n/a
18 TRCN0000143393 GCAATCAGTAGGAAGATGGTT pLKO.1 847 CDS 100% 3.000 1.500 Y MAGEA2B n/a
19 TRCN0000142536 GCCACTTGTACATCCTTGTCA pLKO.1 1043 CDS 100% 3.000 1.500 Y MAGEA12 n/a
20 TRCN0000139290 CAAAGGCAGAAATGCTGGAGA pLKO.1 917 CDS 100% 2.640 1.320 Y MAGEA4 n/a
21 TRCN0000141457 CAGCTATGTGAAAGTCCTGCA pLKO.1 1368 CDS 100% 2.160 1.080 Y MAGEA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321400.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.