Transcript: Human NM_001321592.2

Homo sapiens calcium/calmodulin dependent protein kinase II delta (CAMK2D), transcript variant 33, mRNA.

Source:
NCBI, updated 2019-09-01
Taxon:
Homo sapiens (human)
Gene:
CAMK2D (817)
Length:
1448
CDS:
671..880

Additional Resources:

NCBI RefSeq record:
NM_001321592.2
NBCI Gene record:
CAMK2D (817)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321592.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05930 pDONR223 100% 14% 12.3% None (many diffs) n/a
2 ccsbBroad304_05930 pLX_304 0% 14% 12.3% V5 (many diffs) n/a
3 TRCN0000481368 TGGGGGTCGACGCTCATAGTTAAT pLX_317 29.9% 14% 12.3% V5 (many diffs) n/a
4 ccsbBroadEn_14565 pDONR223 0% 14% 12.3% None (many diffs) n/a
5 ccsbBroad304_14565 pLX_304 0% 14% 12.3% V5 (many diffs) n/a
6 TRCN0000481152 TAATACCTAGCTTTCCAGTGCCAA pLX_317 31.4% 14% 12.3% V5 (many diffs) n/a
Download CSV