Transcript: Human NM_001321741.2

Homo sapiens tetratricopeptide repeat domain 26 (TTC26), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TTC26 (79989)
Length:
3981
CDS:
81..1427

Additional Resources:

NCBI RefSeq record:
NM_001321741.2
NBCI Gene record:
TTC26 (79989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134541 GCTCGGTGCTATATTATGAAT pLKO.1 1065 CDS 100% 5.625 7.875 N TTC26 n/a
2 TRCN0000163459 GAACCTAGCTTGCACCTACTT pLKO.1 365 CDS 100% 4.950 6.930 N TTC26 n/a
3 TRCN0000422579 AGACTAGCCTGGGAACTTTAT pLKO_005 1095 CDS 100% 13.200 9.240 N TTC26 n/a
4 TRCN0000430307 AGATTTCACTGGAGCTATTAC pLKO_005 191 CDS 100% 13.200 9.240 N TTC26 n/a
5 TRCN0000160388 CTAGGCTAAACTTGGTGATTT pLKO.1 622 CDS 100% 13.200 9.240 N TTC26 n/a
6 TRCN0000215496 GCTAGTGAATGTGATACAATA pLKO.1 819 CDS 100% 13.200 9.240 N Ttc26 n/a
7 TRCN0000419810 GCTAGTGAATGTGATACAATA pLKO_005 819 CDS 100% 13.200 9.240 N TTC26 n/a
8 TRCN0000435023 TTGATTTACCTCAACTCATTT pLKO_005 897 CDS 100% 13.200 9.240 N TTC26 n/a
9 TRCN0000160500 CACTCCAGTTTAATCTGTGAT pLKO.1 1487 3UTR 100% 4.950 3.465 N TTC26 n/a
10 TRCN0000164305 CCATAGTCTGTGACCCTGTAT pLKO.1 1606 3UTR 100% 4.950 3.465 N TTC26 n/a
11 TRCN0000136861 CCTAGGAACCAGCTTCTACTT pLKO.1 1442 3UTR 100% 4.950 3.465 N TTC26 n/a
12 TRCN0000134826 CCTCAGGAGTATATTCTCAAA pLKO.1 708 CDS 100% 4.950 3.465 N TTC26 n/a
13 TRCN0000160788 CCTCTTGATCCAAAGTGAGAA pLKO.1 1010 CDS 100% 4.950 3.465 N TTC26 n/a
14 TRCN0000162112 CCTGTATGATCCTAGTAGCAA pLKO.1 1620 3UTR 100% 3.000 2.100 N TTC26 n/a
15 TRCN0000163067 CCCTGAATATTGGGAAGGCAA pLKO.1 1241 CDS 100% 2.640 1.848 N TTC26 n/a
16 TRCN0000160539 CCTCAACTCATTTAAGAGTTA pLKO.1 905 CDS 100% 0.495 0.347 N TTC26 n/a
17 TRCN0000160048 CCAGCTTCTACTTTGACATAA pLKO.1 1450 3UTR 100% 13.200 7.920 N TTC26 n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2497 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2497 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12654 pDONR223 100% 50% 28.7% None (many diffs) n/a
2 ccsbBroad304_12654 pLX_304 0% 50% 28.7% V5 (many diffs) n/a
3 TRCN0000467225 TTCGTTTTAAACCACGATTGTGAA pLX_317 39.8% 50% 28.7% V5 (many diffs) n/a
Download CSV