Construct: ORF TRCN0000467225
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000145.1_s317c1
- Derived from:
- ccsbBroadEn_12654
- DNA Barcode:
- TTCGTTTTAAACCACGATTGTGAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TTC26 (79989)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467225
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_001321742.1 | 100% | 100% | |
2 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_001144920.2 | 54.7% | 54.3% | (many diffs) |
3 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_001321741.2 | 50% | 28.7% | (many diffs) |
4 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_001321740.2 | 49% | 48.7% | (many diffs) |
5 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_024926.4 | 48.1% | 47.8% | (many diffs) |
6 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_001144923.3 | 42.5% | 42.2% | (many diffs) |
7 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_001287513.2 | 29.2% | 28.9% | (many diffs) |
8 | human | 79989 | TTC26 | tetratricopeptide repeat do... | NM_001318333.2 | 22.9% | 22.6% | (many diffs) |
9 | mouse | 264134 | Ttc26 | tetratricopeptide repeat do... | XR_001785135.1 | 53.1% | (many diffs) | |
10 | mouse | 264134 | Ttc26 | tetratricopeptide repeat do... | XM_006506152.3 | 45.8% | 48.2% | (many diffs) |
11 | mouse | 264134 | Ttc26 | tetratricopeptide repeat do... | NM_153600.2 | 42.8% | 45.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 879
- ORF length:
- 813
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gctttcaagg gccaaacctg ctgtaggcag aggcgtacag cacactgaca 121 aaagaaagaa gaaaggtagg aagattccaa aactagagga gctactttca aaaagagatt 181 tcactggagc tattaccctg ttggagttca aacgtcatgt tggggaagaa gaagaggata 241 ctaatttgtg gattggatat tgtgcctttc acctgggtga ctacaagaga gctctggagg 301 aatacgaaaa tgctacaaaa gaggaaaatt gtaattctga agtctgggtg aacctagctt 361 gcacctactt ctttcttggg atgtataaac aagctgaagc agctggattt aaagcttcaa 421 aaagccgact ccaaaaccgc ctcctcttcc acttggctca caagtttaat gatgagaaaa 481 aattgatgag ctttcatcaa aatcttcagg atgtcacaga agatcaactc agtttggcct 541 caatccacta tatgcgaTCT CACTACCAAG AAGCTATAGA TATATATAAG CGAATACTGC 601 TAGATAACAG GGAATACCTT GCCCTTAATG TTTATGTGGC CCTCTGCTAC TACAAGTTGG 661 ATTACTATGA TGTGTCTCAA GAAGTTTTGG CTGTTTACCT TCAGCAAATT CCTGATAGTA 721 CCATCGCACT CAATCTTAAA GCCTGTAACC ATTTTCGCCT TTACAATGGC AGAGCAGCTG 781 AGGCAGAACT CAAAAGCTTG ATGGACAATG CTTCTTCATC CTTTGAATTT GCTAAAGAAC 841 TCATCAGGCA CAATCTGGTG AATAACGATT TCCCGTCTTG CCCAACTTTC TTGTACAAAG 901 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 961 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATTT GTGGAAAGGA 1021 CGATTCGTTT TAAACCACGA TTGTGAAACG CGTTAAGTCg acaatcaacc tctggattac 1081 aaaatttgtg aaagatt