Transcript: Human NM_001321742.1

Homo sapiens tetratricopeptide repeat domain 26 (TTC26), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
TTC26 (79989)
Length:
1227
CDS:
115..930

Additional Resources:

NCBI RefSeq record:
NM_001321742.1
NBCI Gene record:
TTC26 (79989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420129 TAAGCGAATACTGCTAGATAA pLKO_005 636 CDS 100% 13.200 18.480 N TTC26 n/a
2 TRCN0000163459 GAACCTAGCTTGCACCTACTT pLKO.1 399 CDS 100% 4.950 6.930 N TTC26 n/a
3 TRCN0000431881 ATAGTACCATCGCACTCAATC pLKO_005 764 CDS 100% 10.800 8.640 N TTC26 n/a
4 TRCN0000430307 AGATTTCACTGGAGCTATTAC pLKO_005 225 CDS 100% 13.200 9.240 N TTC26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321742.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12654 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12654 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467225 TTCGTTTTAAACCACGATTGTGAA pLX_317 39.8% 100% 100% V5 n/a
Download CSV