Transcript: Human NM_001321958.2

Homo sapiens N-acylsphingosine amidohydrolase 2B (ASAH2B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ASAH2B (653308)
Length:
5145
CDS:
148..630

Additional Resources:

NCBI RefSeq record:
NM_001321958.2
NBCI Gene record:
ASAH2B (653308)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256528 ACGCATTATCTGCTTACATTC pLKO_005 89 5UTR 100% 10.800 6.480 N ASAH2B n/a
2 TRCN0000049517 GCACGCATTATCTGCTTACAT pLKO.1 87 5UTR 100% 5.625 3.375 N ASAH2 n/a
3 TRCN0000256527 GGAAGTTGCTGAAGTTATATT pLKO_005 294 CDS 100% 15.000 7.500 Y ASAH2B n/a
4 TRCN0000256526 CAACAGTGGAATGGCATATTC pLKO_005 479 CDS 100% 13.200 6.600 Y ASAH2B n/a
5 TRCN0000256524 GGACTCCTGGGTCTGAGTAAT pLKO_005 457 CDS 100% 13.200 6.600 Y ASAH2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12304 pDONR223 100% 21.9% 21.9% None 0_1ins1698;2T>C n/a
2 ccsbBroad304_12304 pLX_304 0% 21.9% 21.9% V5 0_1ins1698;2T>C n/a
3 TRCN0000468873 TCTACGGTGGGGTTCCCATGCCAT pLX_317 21.2% 21.9% 21.9% V5 0_1ins1698;2T>C n/a
Download CSV