Transcript: Human NM_001321973.2

Homo sapiens mitochondrial ribosomal protein S11 (MRPS11), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MRPS11 (64963)
Length:
579
CDS:
11..352

Additional Resources:

NCBI RefSeq record:
NM_001321973.2
NBCI Gene record:
MRPS11 (64963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321973.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12505 pDONR223 100% 47.9% 35.4% None (many diffs) n/a
2 ccsbBroad304_12505 pLX_304 0% 47.9% 35.4% V5 (many diffs) n/a
3 TRCN0000471848 TTTCGGCTTCCCCGAACACATCAT pLX_317 87.3% 47.9% 35.4% V5 (many diffs) n/a
4 ccsbBroadEn_03990 pDONR223 100% 47.6% 35.2% None (many diffs) n/a
5 ccsbBroad304_03990 pLX_304 0% 47.6% 35.2% V5 (many diffs) n/a
6 TRCN0000471484 ATCCAAATGCGCGCCAGTTGCCTA pLX_317 78.5% 47.6% 35.2% V5 (many diffs) n/a
Download CSV