Transcript: Human NM_001322099.1

Homo sapiens CCR4-NOT transcription complex subunit 7 (CNOT7), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
CNOT7 (29883)
Length:
2171
CDS:
755..1246

Additional Resources:

NCBI RefSeq record:
NM_001322099.1
NBCI Gene record:
CNOT7 (29883)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017868 CGGTGTAATGTAGACTTGTTA pLKO.1 707 5UTR 100% 5.625 7.875 N CNOT7 n/a
2 TRCN0000318847 CGGTGTAATGTAGACTTGTTA pLKO_005 707 5UTR 100% 5.625 7.875 N CNOT7 n/a
3 TRCN0000095975 GCGGTGTAATGTAGACTTGTT pLKO.1 706 5UTR 100% 4.950 6.930 N Cnot7 n/a
4 TRCN0000017869 GCTACTAACAACATCTGGTAT pLKO.1 853 CDS 100% 4.950 3.960 N CNOT7 n/a
5 TRCN0000017870 GCTGACTATCAATACCAACTA pLKO.1 683 5UTR 100% 4.950 3.960 N CNOT7 n/a
6 TRCN0000318848 GCTGACTATCAATACCAACTA pLKO_005 683 5UTR 100% 4.950 3.960 N CNOT7 n/a
7 TRCN0000017872 CGGTTACGACTTTGGCTACTT pLKO.1 985 CDS 100% 4.950 3.465 N CNOT7 n/a
8 TRCN0000349651 CGGTTACGACTTTGGCTACTT pLKO_005 985 CDS 100% 4.950 3.465 N CNOT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11909 pDONR223 100% 63.3% 62.6% None (many diffs) n/a
2 ccsbBroad304_11909 pLX_304 0% 63.3% 62.6% V5 (many diffs) n/a
3 TRCN0000475112 AAGTTTTCGTATTTGATCATCATC pLX_317 49.3% 63.3% 62.6% V5 (many diffs) n/a
4 ccsbBroadEn_03097 pDONR223 100% 56.9% 56.8% None 0_1ins243;487G>A;489_489delAins124 n/a
5 ccsbBroad304_03097 pLX_304 0% 56.9% 56.8% V5 0_1ins243;487G>A;489_489delAins124 n/a
6 TRCN0000466126 TCGAGCCATATCGGGGGAGGTCTG pLX_317 43.4% 56.9% 56.8% V5 0_1ins243;487G>A;489_489delAins124 n/a
Download CSV