Construct: ORF TRCN0000466126
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004938.1_s317c1
- Derived from:
- ccsbBroadEn_03097
- DNA Barcode:
- TCGAGCCATATCGGGGGAGGTCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CNOT7 (29883)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466126
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322090.2 | 100% | 100% | |
| 2 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322091.2 | 100% | 100% | |
| 3 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322092.2 | 100% | 100% | |
| 4 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_013354.7 | 100% | 100% | |
| 5 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | XM_005273481.3 | 100% | 100% | |
| 6 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322093.2 | 92.8% | 92.8% | 312_377del |
| 7 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322094.2 | 87.6% | 83.6% | (many diffs) |
| 8 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322087.1 | 85.3% | 85.2% | 730G>A;732_732delAins124 |
| 9 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322088.1 | 85.3% | 85.2% | 730G>A;732_732delAins124 |
| 10 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322089.1 | 85.3% | 85.2% | 730G>A;732_732delAins124 |
| 11 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_054026.3 | 85.3% | 85.2% | 730G>A;732_732delAins124 |
| 12 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322095.2 | 71.5% | 71.5% | 0_1ins243 |
| 13 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322096.2 | 71.5% | 71.5% | 0_1ins243 |
| 14 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322097.2 | 71.5% | 71.5% | 0_1ins243 |
| 15 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322098.1 | 56.9% | 56.8% | 0_1ins243;487G>A;489_489delAins124 |
| 16 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322099.1 | 56.9% | 56.8% | 0_1ins243;487G>A;489_489delAins124 |
| 17 | human | 29883 | CNOT7 | CCR4-NOT transcription comp... | NM_001322100.1 | 56.9% | 56.8% | 0_1ins243;487G>A;489_489delAins124 |
| 18 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | NM_001271542.1 | 93% | 99.6% | (many diffs) |
| 19 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | NM_011135.5 | 93% | 99.6% | (many diffs) |
| 20 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | XM_011242183.1 | 93% | 99.6% | (many diffs) |
| 21 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | XM_006509306.2 | 89% | 95.3% | (many diffs) |
| 22 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | XM_011242180.2 | 89% | 95.3% | (many diffs) |
| 23 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | NM_001271543.1 | 81.6% | 86.6% | (many diffs) |
| 24 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | XM_006509307.3 | 58.1% | 62.4% | (many diffs) |
| 25 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | XR_001778412.1 | 29.2% | (many diffs) | |
| 26 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | XR_378910.2 | 22% | (many diffs) | |
| 27 | mouse | 18983 | Cnot7 | CCR4-NOT transcription comp... | XR_378909.2 | 21.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 921
- ORF length:
- 855
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc agcggcaact gtagatcata gccaaagaat ttgtgaagtt tgggcttgca 121 acttggatga agagatgaag aaaattcgtc aagttatccg aaaatataat tacgttgcta 181 tggacaccga gtttccaggt gtggttgcaa gacccattgg agaattcagg agcaatgctg 241 actatcaata ccaactattg cggtgtaatg tagacttgtt aaagataatt cagctaggac 301 tgacatttat gaatgagcaa ggagaatacc ctccaggaac ttcaacttgg cagtttaatt 361 ttaaatttaa tttgacggag gacatgtatg cccaggactc tatagagcta ctaacaacat 421 ctggtatcca gtttaaaaaa catgaggagg aaggaattga aacccagtac tttgcagaac 481 ttcttatgac ttctggagtg gtcctctgtg aaggggtcaa atggttgtca tttcatagcg 541 gttacgactt tGGCTACTTA ATCAAAATCC TAACCAACTC TAACTTGCCT GAAGAAGAAC 601 TTGACTTCTT TGAGATCCTT CGATTGTTTT TTCCTGTCAT TTATGATGTG AAGTACCTCA 661 TGAAGAGCTG CAAAAATCTC AAAGGTGGAT TACAGGAGGT GGCAGAACAG TTAGAGCTGG 721 AACGGATAGG ACCACAACAT CAGGCAGGAT CTGATTCATT GCTCACAGGA ATGGCCTTTT 781 TCAAAATGAG AGAAATGTTC TTTGAAGATC ATATTGATGA TGCCAAATAT TGTGGTCATT 841 TGTATGGCCT TGGTTCTGGT TCATCCTATG TACAGAATGG CACAGGGAAT GCATATGAAG 901 AGGAAGCCAA CAAGCAGTCA TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATCGA GCCATATCGG 1081 GGGAGGTCTG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt