Transcript: Human NM_001322182.2

Homo sapiens dopachrome tautomerase (DCT), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
DCT (1638)
Length:
4289
CDS:
576..1202

Additional Resources:

NCBI RefSeq record:
NM_001322182.2
NBCI Gene record:
DCT (1638)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049138 GCTGACAATAAAGGAACTAAT pLKO.1 1254 3UTR 100% 13.200 10.560 N DCT n/a
2 TRCN0000433395 GTTGGCCCACAACTCTCTTAG pLKO_005 1045 CDS 100% 10.800 8.640 N DCT n/a
3 TRCN0000424561 TGCTTTGGAAGGGTTTGATAA pLKO_005 689 CDS 100% 13.200 9.240 N DCT n/a
4 TRCN0000432534 ATAGTGATGATGATCTCATTC pLKO_005 1322 3UTR 100% 10.800 7.560 N DCT n/a
5 TRCN0000430351 CACATCAAGGACCTGCATTTG pLKO_005 271 5UTR 100% 10.800 7.560 N DCT n/a
6 TRCN0000049140 GCTTTGCCCTACTGGAACTTT pLKO.1 363 5UTR 100% 5.625 3.938 N DCT n/a
7 TRCN0000049139 CCAGAACTCTACCTTCAGTTT pLKO.1 662 CDS 100% 4.950 3.465 N DCT n/a
8 TRCN0000111883 CCTATGAAGGTTTGCTGAGAA pLKO.1 547 5UTR 100% 4.950 3.465 N Dct n/a
9 TRCN0000049142 CCTCCAGTGACTAATGAAGAA pLKO.1 951 CDS 100% 4.950 3.465 N DCT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00427 pDONR223 100% 40% 40% None 0_1ins933 n/a
2 ccsbBroad304_00427 pLX_304 0% 40% 40% V5 0_1ins933 n/a
3 TRCN0000467690 TACACGGGCCCTAACCAGGCATTT pLX_317 22.7% 40% 40% V5 0_1ins933 n/a
Download CSV