Transcript: Human NM_001322226.2

Homo sapiens very low density lipoprotein receptor (VLDLR), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
VLDLR (7436)
Length:
9006
CDS:
404..2818

Additional Resources:

NCBI RefSeq record:
NM_001322226.2
NBCI Gene record:
VLDLR (7436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370553 CATCCTCTTGCACTAACAATA pLKO_005 2216 CDS 100% 13.200 18.480 N VLDLR n/a
2 TRCN0000054324 GCACAGATGATGATCTAGCTT pLKO.1 2796 CDS 100% 3.000 4.200 N VLDLR n/a
3 TRCN0000348222 TATCTGCAAAGACCTAGTTAT pLKO_005 1387 CDS 100% 13.200 10.560 N Vldlr n/a
4 TRCN0000365541 TATCTGCAAAGACCTAGTTAT pLKO_005 1387 CDS 100% 13.200 10.560 N VLDLR n/a
5 TRCN0000370552 ATGATCGACAATGTCTATAAT pLKO_005 1802 CDS 100% 15.000 10.500 N VLDLR n/a
6 TRCN0000054327 CCTGAAAGAGTGTCATATAAA pLKO.1 1333 CDS 100% 15.000 10.500 N VLDLR n/a
7 TRCN0000365439 AGATCGTAGGATAGTACTAAA pLKO_005 2176 CDS 100% 13.200 9.240 N VLDLR n/a
8 TRCN0000365489 CCAGTGGCCTAACGGAATTAC pLKO_005 2077 CDS 100% 13.200 9.240 N VLDLR n/a
9 TRCN0000313092 TGCGGCTTCTAAGACTATTTC pLKO_005 1873 CDS 100% 13.200 9.240 N Vldlr n/a
10 TRCN0000370551 GTTGACCTTTGAGGTCTAAAC pLKO_005 2833 3UTR 100% 10.800 7.560 N VLDLR n/a
11 TRCN0000054326 GCTTGATTCTAAGTTGCACAT pLKO.1 2128 CDS 100% 4.050 2.835 N VLDLR n/a
12 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 5281 3UTR 100% 4.950 2.475 Y NPHS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07130 pDONR223 100% 95.1% 95% None 325_326ins123;798C>T n/a
2 ccsbBroad304_07130 pLX_304 0% 95.1% 95% V5 325_326ins123;798C>T n/a
3 TRCN0000477051 ATCCACGGCTCCCCCACAAACACA pLX_317 19.2% 95.1% 95% V5 325_326ins123;798C>T n/a
Download CSV