Transcript: Human NM_001322314.2

Homo sapiens phosphatase and actin regulator 1 (PHACTR1), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PHACTR1 (221692)
Length:
5692
CDS:
334..2286

Additional Resources:

NCBI RefSeq record:
NM_001322314.2
NBCI Gene record:
PHACTR1 (221692)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262579 AGACGACGACAGCTCATTATA pLKO_005 1752 CDS 100% 15.000 21.000 N PHACTR1 n/a
2 TRCN0000262580 AGCAGAGAAGAGCTGATAAAG pLKO_005 781 CDS 100% 13.200 9.240 N PHACTR1 n/a
3 TRCN0000262578 ATGAATTGAGTAGACACTTAA pLKO_005 2246 CDS 100% 13.200 9.240 N PHACTR1 n/a
4 TRCN0000262577 TGATTGAATGTGATGACAATA pLKO_005 1649 CDS 100% 13.200 9.240 N PHACTR1 n/a
5 TRCN0000262576 AGGACTCCTTAGCCATCAAAC pLKO_005 1805 CDS 100% 10.800 7.560 N PHACTR1 n/a
6 TRCN0000052750 GAACTCTCTATATCCAATGAA pLKO.1 838 CDS 100% 5.625 3.938 N PHACTR1 n/a
7 TRCN0000052751 GAACTGGAACAGAGGAACATT pLKO.1 1963 CDS 100% 5.625 3.938 N PHACTR1 n/a
8 TRCN0000121491 CCAACTGTTGTGATTGAATGT pLKO.1 1639 CDS 100% 4.950 3.465 N Phactr1 n/a
9 TRCN0000262581 TTGAGTGCTATGCTGTCTTCA pLKO_005 2301 3UTR 100% 4.950 3.465 N PHACTR1 n/a
10 TRCN0000052748 CGAAGACTCTTCTTGCCTGTA pLKO.1 1698 CDS 100% 4.050 2.835 N PHACTR1 n/a
11 TRCN0000262583 ATTTATAAGAACCATAAGTGC pLKO_005 2330 3UTR 100% 2.640 1.848 N PHACTR1 n/a
12 TRCN0000262582 CCTATGGGCCTTCCAGAAATA pLKO_005 1609 CDS 100% 13.200 7.920 N PHACTR1 n/a
13 TRCN0000262584 GAGTCCTGAAGGAAATCTATG pLKO_005 806 CDS 100% 10.800 6.480 N PHACTR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322314.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05264 pDONR223 100% 80% 72.9% None (many diffs) n/a
2 ccsbBroad304_05264 pLX_304 0% 80% 72.9% V5 (many diffs) n/a
3 TRCN0000479401 CTCTTGGCCCTTGTGTATGAAGCC pLX_317 11.2% 80% 72.9% V5 (many diffs) n/a
Download CSV