Transcript: Human NM_001322880.2

Homo sapiens sarcoglycan zeta (SGCZ), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SGCZ (137868)
Length:
7222
CDS:
809..1624

Additional Resources:

NCBI RefSeq record:
NM_001322880.2
NBCI Gene record:
SGCZ (137868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001322880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150690 GAATCCGACTTGAAGGTATAT pLKO.1 1077 CDS 100% 13.200 18.480 N SGCZ n/a
2 TRCN0000098359 CATGATAGTTAACTTAGCCAT pLKO.1 985 CDS 100% 2.640 3.696 N Sgcz n/a
3 TRCN0000151680 GACTGAGAATGCACAACTTTA pLKO.1 898 CDS 100% 13.200 9.240 N SGCZ n/a
4 TRCN0000098355 GTTGGTTACCATGATAGTTAA pLKO.1 976 CDS 100% 13.200 9.240 N Sgcz n/a
5 TRCN0000155536 GATGGCGAAAGAGGTGCTTAT pLKO.1 936 CDS 100% 10.800 7.560 N SGCZ n/a
6 TRCN0000154380 CCCAAGATCTCAGGCTTGAAT pLKO.1 1293 CDS 100% 5.625 3.938 N SGCZ n/a
7 TRCN0000155470 GCGAAGTGAAGCACACAGTTT pLKO.1 1905 3UTR 100% 4.950 3.465 N SGCZ n/a
8 TRCN0000150527 GAGAATAACATAGGTGCCTTT pLKO.1 1879 3UTR 100% 4.050 2.835 N SGCZ n/a
9 TRCN0000154449 GTTCCACTTGTCAGTCCAGTA pLKO.1 1581 CDS 100% 4.050 2.835 N SGCZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001322880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13194 pDONR223 100% 71.7% 71.7% None 1_39del;234_335del;422_423ins123 n/a
2 ccsbBroad304_13194 pLX_304 0% 71.7% 71.7% V5 1_39del;234_335del;422_423ins123 n/a
3 TRCN0000465634 AGCACCTTTTTCTGGCCAACCAGT pLX_317 35.3% 71.7% 71.7% V5 1_39del;234_335del;422_423ins123 n/a
Download CSV