Transcript: Human NM_001323424.2

Homo sapiens RNA binding motif protein 39 (RBM39), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RBM39 (9584)
Length:
5057
CDS:
334..1923

Additional Resources:

NCBI RefSeq record:
NM_001323424.2
NBCI Gene record:
RBM39 (9584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232611 GCCTCTAGCAATAGGATTAAC pLKO_005 951 CDS 100% 13.200 18.480 N RBM39 n/a
2 TRCN0000232613 GCTTCGAGTGCTAGTTCATTT pLKO_005 1324 CDS 100% 13.200 18.480 N RBM39 n/a
3 TRCN0000306959 GCTTCGAGTGCTAGTTCATTT pLKO_005 1324 CDS 100% 13.200 18.480 N Rbm39 n/a
4 TRCN0000021773 CCAAGGGATTTGGAAGAGTTT pLKO.1 826 CDS 100% 4.950 6.930 N RBM39 n/a
5 TRCN0000021771 CCAAGGGATATGGATTTATTA pLKO.1 1199 CDS 100% 15.000 10.500 N RBM39 n/a
6 TRCN0000232610 AGAAGTCGAGATCGAAGATTT pLKO_005 586 CDS 100% 13.200 9.240 N RBM39 n/a
7 TRCN0000021770 GCTGGACCTATGAGGCTTTAT pLKO.1 1069 CDS 100% 13.200 9.240 N RBM39 n/a
8 TRCN0000232612 ATATGCTTCGTGGGATCTTTG pLKO_005 1121 CDS 100% 10.800 7.560 N RBM39 n/a
9 TRCN0000232614 ATCTTGCATTCTGATCAATTG pLKO_005 2393 3UTR 100% 10.800 7.560 N RBM39 n/a
10 TRCN0000021772 CCAACTTACCACAACCTGTTT pLKO.1 1855 CDS 100% 4.950 3.465 N RBM39 n/a
11 TRCN0000021769 GCCGTGAAAGAAAGCGAAGTA pLKO.1 536 CDS 100% 4.950 3.465 N RBM39 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4890 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4890 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323424.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15672 pDONR223 0% 96% 96% None 298_360del n/a
2 ccsbBroad304_15672 pLX_304 0% 96% 96% V5 298_360del n/a
Download CSV