Transcript: Human NM_001323555.2

Homo sapiens EFR3 homolog A (EFR3A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
EFR3A (23167)
Length:
6510
CDS:
1406..3763

Additional Resources:

NCBI RefSeq record:
NM_001323555.2
NBCI Gene record:
EFR3A (23167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160467 CCACTGTTAAGTAGTATGTTT pLKO.1 4031 3UTR 100% 5.625 7.875 N EFR3A n/a
2 TRCN0000160876 GACATCGTTCTGGGTATGTTT pLKO.1 1500 CDS 100% 5.625 7.875 N EFR3A n/a
3 TRCN0000158956 GCGCATTTAGATCATCACAAA pLKO.1 2072 CDS 100% 4.950 6.930 N EFR3A n/a
4 TRCN0000161557 GAAGAAGTTGACAGTCGCATA pLKO.1 1922 CDS 100% 4.050 5.670 N EFR3A n/a
5 TRCN0000164119 CCGTATCCATTCAGGTGGATA pLKO.1 3402 CDS 100% 0.495 0.693 N EFR3A n/a
6 TRCN0000439038 GCTAGGTGGAAGTGGATATAG pLKO_005 3301 CDS 100% 13.200 9.240 N EFR3A n/a
7 TRCN0000160236 CAACTTTGTAAGTCAGATGAT pLKO.1 3112 CDS 100% 4.950 3.465 N EFR3A n/a
8 TRCN0000163061 CCATCAGGAACACTGACCATT pLKO.1 3671 CDS 100% 4.950 3.465 N EFR3A n/a
9 TRCN0000194436 GCCAGCATGTTAGCAAGGTTA pLKO.1 3150 CDS 100% 4.950 3.465 N Efr3a n/a
10 TRCN0000159224 CTGGCTAATGAAGAAGTAGTT pLKO.1 2981 CDS 100% 4.950 2.970 N EFR3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323555.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.