Transcript: Human NM_001323584.2

Homo sapiens Suv3 like RNA helicase (SUPV3L1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SUPV3L1 (6832)
Length:
2525
CDS:
500..2467

Additional Resources:

NCBI RefSeq record:
NM_001323584.2
NBCI Gene record:
SUPV3L1 (6832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296250 ACGATTGTCAGGAACCTTAAA pLKO_005 2197 CDS 100% 13.200 18.480 N SUPV3L1 n/a
2 TRCN0000050348 GCAGAGTTGATCCAGCATATT pLKO.1 1778 CDS 100% 13.200 18.480 N SUPV3L1 n/a
3 TRCN0000050349 CCGATACATCAAATGGCCTTT pLKO.1 1933 CDS 100% 4.050 5.670 N SUPV3L1 n/a
4 TRCN0000050350 CGTGTGACAGTTCAGCCAAAT pLKO.1 881 CDS 100% 10.800 8.640 N SUPV3L1 n/a
5 TRCN0000289397 CGTGTGACAGTTCAGCCAAAT pLKO_005 881 CDS 100% 10.800 8.640 N SUPV3L1 n/a
6 TRCN0000296289 CCACGATGTCTTGGATCTTTA pLKO_005 1999 CDS 100% 13.200 9.240 N SUPV3L1 n/a
7 TRCN0000050351 GCTGAGCAGATTGAAATGTTT pLKO.1 1646 CDS 100% 5.625 3.938 N SUPV3L1 n/a
8 TRCN0000050352 CCTGTGTTGGACTGTAAGGAT pLKO.1 617 CDS 100% 3.000 2.100 N SUPV3L1 n/a
9 TRCN0000306830 CCTGTGTTGGACTGTAAGGAT pLKO_005 617 CDS 100% 3.000 2.100 N SUPV3L1 n/a
10 TRCN0000295263 TGGCTAAGCTACCGATTTATT pLKO_005 2024 CDS 100% 15.000 10.500 N Supv3l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323584.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01624 pDONR223 100% 83.3% 83.3% None 0_1ins393 n/a
2 ccsbBroad304_01624 pLX_304 0% 83.3% 83.3% V5 0_1ins393 n/a
3 TRCN0000467206 GACTGTCGCGAGATGACGCACAAT pLX_317 18.1% 83.3% 83.3% V5 0_1ins393 n/a
Download CSV