Transcript: Human NM_001323594.1

Homo sapiens nucleotide binding protein 1 (NUBP1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
NUBP1 (4682)
Length:
1064
CDS:
9..818

Additional Resources:

NCBI RefSeq record:
NM_001323594.1
NBCI Gene record:
NUBP1 (4682)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188806 CGAGAGAATGTTCAGGACCAA pLKO.1 821 3UTR 100% 2.640 1.848 N NUBP1 n/a
2 TRCN0000349663 CGAGAGAATGTTCAGGACCAA pLKO_005 821 3UTR 100% 2.640 1.848 N NUBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323594.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10988 pDONR223 100% 84.5% 83.8% None (many diffs) n/a
2 ccsbBroad304_10988 pLX_304 0% 84.5% 83.8% V5 (many diffs) n/a
3 TRCN0000477882 AGACTGTTTACCAAGGGGTCAGGT pLX_317 23.5% 84.5% 83.8% V5 (many diffs) n/a
Download CSV