Construct: ORF TRCN0000477882
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014813.1_s317c1
- Derived from:
- ccsbBroadEn_10988
- DNA Barcode:
- AGACTGTTTACCAAGGGGTCAGGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NUBP1 (4682)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477882
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 4682 | NUBP1 | nucleotide binding protein 1 | NM_001278506.1 | 100% | 100% | |
2 | human | 4682 | NUBP1 | nucleotide binding protein 1 | NM_002484.4 | 96.5% | 96.5% | 327_359del |
3 | human | 4682 | NUBP1 | nucleotide binding protein 1 | XM_017023252.1 | 93.4% | 92.8% | (many diffs) |
4 | human | 4682 | NUBP1 | nucleotide binding protein 1 | NM_001323595.1 | 87.8% | 87.8% | 327_359del;820_821ins84 |
5 | human | 4682 | NUBP1 | nucleotide binding protein 1 | NM_001323594.1 | 84.5% | 83.8% | (many diffs) |
6 | human | 4682 | NUBP1 | nucleotide binding protein 1 | NM_001323596.1 | 77.5% | 70.3% | 327_359del;715_716ins103;777_778ins80 |
7 | human | 4682 | NUBP1 | nucleotide binding protein 1 | NM_001323597.1 | 72.7% | 68.4% | (many diffs) |
8 | mouse | 26425 | Nubp1 | nucleotide binding protein 1 | NM_011955.2 | 82.5% | 85.6% | (many diffs) |
9 | mouse | 26425 | Nubp1 | nucleotide binding protein 1 | XR_384565.3 | 53% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 996
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggaggaggtg cctcacgact gtccaggggc cgacagcgcc caggcgggca 121 gaggggcttc atgtcaggga tgccccaacc agcggctgtg cgcttctgga gcgggggcca 181 ctccggacac ggctatagag gaaatcaaag agaaaatgaa gactgtaaaa cacaaaatct 241 tggtattgtc tgggaaaggc ggtgttggga aaagcacatt cagcgcccac cttgcccatg 301 gcctagcaga ggatgaaaac acacagattg ctcttctaga catcgatata tgtgggccat 361 cgattcccaa gataatggga ttggaaggag agcagtacgt ggaagacaac ctgggggtga 421 tgtcagtggg cttcctgctc agcagtcctg atgatgctgt tatctggagg ggacccaaga 481 aaaacggcat gatcaagcag ttcctccgag atgtggactg gggagaggtc gactacctca 541 ttgtggacac cccacctggg acgtcggatg aacacctctc ggtcgtccgg tacctggcca 601 cagcacacat cgatggagca gtgatcatca ccactcccca ggaggtgtca ctccaggatg 661 tccggaaaga aatcaacttc tgccgcaagg tgaagctgcc catcatcggg gtggtggaga 721 acatgagtgg cttcatctgt cctaagtgca agaaagaatc tcagatattc cctcccacaa 781 ccGGGGGCGC GGAGCTCATG TGCCAGGACT TGGAGGTCCC TCTCCTCGGC AGAGTGCCCC 841 TGGATCCGCT CATAGGTAAG AATTGTGACA AAGGCCAGTC TTTTTTCATT GACGCCCCAG 901 ATTCCCCAGC CACGTTAGCC TACAGAAGTA TAATTCAGAG AATCCAAGAG TTTTGTAATC 961 TCCATCAGTC AAAAGAAGAG AACCTCATCA GTTCCTTGCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 AAGACTGTTT ACCAAGGGGT CAGGTACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt