Transcript: Human NM_001324063.1

Homo sapiens MIA SH3 domain ER export factor 3 (MIA3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MIA3 (375056)
Length:
7949
CDS:
10..5556

Additional Resources:

NCBI RefSeq record:
NM_001324063.1
NBCI Gene record:
MIA3 (375056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256913 CTATATGTCCTCCCGTTTAAT pLKO_005 7177 3UTR 100% 15.000 21.000 N MIA3 n/a
2 TRCN0000256917 TGTTGTGAAGGATAGAGTATA pLKO_005 3615 CDS 100% 13.200 18.480 N MIA3 n/a
3 TRCN0000256916 GAATTGGATACTGAGTATTAT pLKO_005 925 CDS 100% 15.000 10.500 N MIA3 n/a
4 TRCN0000256915 GATAAGATTGATGCCTATAAA pLKO_005 784 CDS 100% 15.000 10.500 N MIA3 n/a
5 TRCN0000256908 GGAGAGCCTGCCCTATAATAT pLKO_005 2901 CDS 100% 15.000 10.500 N MIA3 n/a
6 TRCN0000256910 TCGATGAAGGCAAGGTTAATA pLKO_005 5081 CDS 100% 15.000 10.500 N MIA3 n/a
7 TRCN0000256911 TTAGGACTGTGAGGGTTATAA pLKO_005 6564 3UTR 100% 15.000 10.500 N MIA3 n/a
8 TRCN0000256909 AGCGGTTCCAGAAGTACTTTA pLKO_005 2819 CDS 100% 13.200 9.240 N MIA3 n/a
9 TRCN0000256912 GAGCCTCCGTGTCCACTAAAT pLKO_005 4268 CDS 100% 13.200 9.240 N MIA3 n/a
10 TRCN0000256914 GGTAGTTGAAGAGGATCTAAA pLKO_005 4227 CDS 100% 13.200 9.240 N MIA3 n/a
11 TRCN0000128582 GCAGGCTTCATTTGAATCTTT pLKO.1 678 CDS 100% 5.625 3.938 N MIA3 n/a
12 TRCN0000129670 CAGAGGAAAGTGATAGTGTAT pLKO.1 566 CDS 100% 4.950 3.465 N MIA3 n/a
13 TRCN0000127754 GAGCTACAAGTTCCAACAGAT pLKO.1 343 CDS 100% 4.950 3.465 N MIA3 n/a
14 TRCN0000128078 GCAATAGTTCTCAGGTCTCAA pLKO.1 755 CDS 100% 4.950 3.465 N MIA3 n/a
15 TRCN0000129469 GCCAACTCAGAGGAAAGTGAT pLKO.1 559 CDS 100% 4.950 3.465 N MIA3 n/a
16 TRCN0000127755 GCTGATGCACTTGTATCTGAT pLKO.1 856 CDS 100% 4.950 3.465 N MIA3 n/a
17 TRCN0000129808 CCAACAGATAAAGAGCAGAAT pLKO.1 1060 CDS 100% 4.950 2.970 N MIA3 n/a
18 TRCN0000201732 GAACCTGAACCTGAACCAGTA pLKO.1 535 CDS 100% 4.050 2.430 N Cngb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13632 pDONR223 100% 24.9% 24.8% None 1_4161del;4798G>T;4990A>G n/a
2 ccsbBroad304_13632 pLX_304 0% 24.9% 24.8% V5 1_4161del;4798G>T;4990A>G n/a
3 TRCN0000465674 TATCTAACCTTTAGAGGGCCCGGT pLX_317 26% 24.9% 24.8% V5 1_4161del;4798G>T;4990A>G n/a
Download CSV