Transcript: Human NM_001324216.1

Homo sapiens ELAV like RNA binding protein 4 (ELAVL4), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
ELAVL4 (1996)
Length:
2381
CDS:
271..657

Additional Resources:

NCBI RefSeq record:
NM_001324216.1
NBCI Gene record:
ELAVL4 (1996)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038706 CCGACATCCAATACAAGCAAT pLKO.1 316 CDS 100% 4.950 6.930 N ELAVL4 n/a
2 TRCN0000038708 GTTTAGGGTATGGATTTGTTA pLKO.1 527 CDS 100% 5.625 3.938 N ELAVL4 n/a
3 TRCN0000112096 CCAACCTCATCGTCAACTATT pLKO.1 407 CDS 100% 13.200 6.600 Y Elavl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06154 pDONR223 100% 33.9% 32.5% None (many diffs) n/a
2 ccsbBroad304_06154 pLX_304 0% 33.9% 32.5% V5 (many diffs) n/a
3 TRCN0000470496 AAACATACCGACTTGACATAGCAG pLX_317 45.3% 33.9% 32.5% V5 (many diffs) n/a
Download CSV